signature=abcea710e8925522bb7987d7b1618edd,MANUFACTURING METHOD OF RECOMBINANT PROTEIN IN YEAST BY T...

Manufacturing method of recombinant protein in yeast by the use of secretory type vector FIELD OF THE INVENTION The present invention relates to a process for producing a secretory protein by the use of Saccharomyces cereviseae, to a vector used therefor and to yeast comprising the vector. The present invention relates, in particular, to a process for producing various secretory proteins including naturally-occurring human granulocyte-colony stimulating factor (hereinafter referred to as G-CSF) by providing a yeast expression vector possessing a novel complex secretory signal which facilitates secretion and extracellular expression, and especially by providing novel nucleotide sequences of human G-CSF gene by the use of yeast preference codons which increase the translation efficiency of yeast. Herein, by"secretory proteins"is meant that recombinant proteins are expressed and secreted to the outside of cells, that is, to a culture medium. The use of said yeast expression vector can lead to the production of recombinant proteins, useful to the human body, in yeast in a secreted form outside the cell. Examples of such secretory proteins include G-CSF, growth hormone, granulocyte-macrophage colony stimulating factor, interferon and the like.

Specifically, the present invention relates to a process for producing naturally- occurring human G-CSF from normal yeast by the use of the novel yeast expression vector. More specifically, the present invention relates to a novel G-CSF gene nucleotide sequence which promotes protein translation in yeast, to a novel complex secretory signal which increases the secretion and extracellular expression in yeast, and to a method for the removal of exogenous amino acids introduced at the amino terminal of the secreted G-CSF.

BACKGROUND OF THE INVENTION G-CSF has been known to stimulate growth and differentiation of neutrophilic granulocytes as one of colony stimulating factors which facilitate the differentiation and proliferation of bone marrow cells (Nicola et al. , J. Biol. Chem. 252,9017 (1983) ). G-CSF has been purified from human bladder carcinoma cells (Welte et al., Proc. Natl. Sci. , 82,1526 (1985) ). Thereafter, naturally-occurring cDNA nucleotide sequences have been identified (Shigekazu et al., Nature, 319,415 (1986) ; Souza et al., Science, 232,61 (1986) ).

Naturally-occurring G-CSF is a glycoprotein having a molecular weight of 19,600 dalton (Da), and can be used in the recovery of immune cells destroyed by chemotherapy for anti-cancer treatment, because it functions in combination with neutrophilic granulocytes to facilitate the rapid division of neutrophilic granulocytes.

It may also be useful as a therapeutic agent for use in bone marrow transplants, severe burns and leukemia.

The existing processes for producing G-CSF in commercial quantities include the process according to Amgen Inc. of U. S. A. wherein Escherichia coli (E. coli) is employed (U. S. Patent 4,810, 643), and the process according to Chugai Kabushiki Kaisha of Japan wherein Chinese Hamster Ovary (hereinafter referred to as CHO) cells are employed (European Patent Publication No. 0,215, 126A1).

The process using Escherichia coli is advantageous in view of the fact that G- CSF can be produced in a form of non-glycosylated protein with high expression level.

The process is, however, disadvantageous in view of the facts that the amino terminal further includes a methionin residue, which is not found in naturally-occurring

proteins, and that the purification steps are complicated due to the removal of Escherichia coli derived endotoxin material and protein refolding.

The process using CHO animal cell is advantageous in that G-CSF can be produced in a form of glycosylated protein which is very similar to naturally- occurring G-CSF. The process is, however, disadvantageous in view of the facts that the cost of production was extremely high and that there were possibilities of animal- derived virus or prions being co-isolated.

It has been reported that the glycosylation of G-CSF does not largely affect the biological titer. For example, the specific physiological activity of G-CSF produced by Amgen Inc. is approximately one million IU/mg and that of G-CSF produced by Chugai Kabushiki Kaisha is approximately 1.28 million IU/mg. Accordingly, the application of microorganisms with low production cost may be advantageous in order to produce G-CSF in commercial quantities.

As mentioned above, however, the process using Escherichia coli had problems in its production steps in that its post treatment process is complex and is associated with contamination risk, and hence there has been increasing need to solve such problems.

SUMMARY OF INVENTION It is an object of the present invention to solve the problems of the prior arts and to provide a process for producing and secreting non-glycosylated, naturally- occurring secretory proteins in yeast, which is characterized by the facts that the process does not utilize Escherichia coli or animal cells; no unnecessary amino acids are added at the N-terminal of the secretory proteins; the level of secretion and

extracellular expression is increased; the possibility of contamination with endotoxin or animal-derived foreign pathogens is minimized; and the purification steps are simple. It is another object of the invention to provide a vector for protein expression in yeast.

The present inventors have conducted concentrated studies in order to attain the above object. Namely, the present invention provides a novel complex secretory signal allowing secretion and extracellular expression to be optimized in yeast, a vector for protein expression in yeast comprising the same, a nucleotide sequence of a gene encoding a protein in which yeast preference codons are employed, yeast cells comprising the above, and a process for producing a secretory recombinant protein by using the yeast cells.

The yeast preference codons used herein are selected from the two most common codons in tRNA encoding individual amino acids in yeast cells (The Molecular Biology of the Yeast saccharomyces, Metabolism and Gene Expression, p. 490, Cold Spring Harbor, N. Y. , Cold Spring Harbor Laboratory, 1982).

More specifically, the present invention provides the following (1) to (21).

(1) A process for producing hG-CSF protein, which comprises using yeast transformed with a vector for protein expression in yeast, wherein the vector comprises a nucleotide sequence encoding hG-CSF protein.

(2) A process for producing hG-CSF protein according to (1) above, wherein the vector for protein expression in yeast comprises a complex secretory signal sequence which increases secretion and extracellular expression.

(3) A process for producing hG-CSF protein according to (2) above, wherein the nucleotide sequences of the vector for protein expression in yeast is substituted

with yeast preference codons without changing the amino acid sequence, thereby allowing the protein expression to be optimized.

(4) A process for producing hG-CSF protein according to (3) above, wherein the hG-CSF is expressed by a synthetic G-CSF gene having a nucleotide sequence as shown in SEQ ID NO: 46, in which yeast preference codons are employed. An example of employing yeast preference codons includes the substitution wherein codon CCC encoding proline, which is the second amino acid of naturally-occurring hG-CSF, is replaced by CCA, also encoding proline. This is because CCA is preferred rather than CCC upon protein expression in yeast. If the nucleotide sequence of synthetic G-CSF gene is replaced by yeast preference codons in this manner, the translation efficiency of the gene may be enhanced, thereby the expression efficiency of protein may be further increased.

(5) A process for producing hG-CSF protein according to (1) above, wherein the vector comprises an inducible yeast promoter, a complex secretory signal, a yeast transcription terminator, selection markers, and a yeast replication origin, thereby enhancing the secretion and extracellular expression of secretory recombinant protein.

These elements are not particularly limited, and for example, ADH2/GAPDH mixed promoter may be preferably used for the inducible yeast promoter, a GAP terminator sequence may be preferably used for the yeast transcription terminator, a marker gene and a URA3 gene may be preferably used for the selection markers, and a 2p ori sequence may be preferably used for the yeast replication orgin.

(6) A process for producing hG-CSF protein according to (2) above, wherein the complex secretory signal comprises a nucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 7.

(7) A process for producing hG-CSF protein according to (2) above, wherein the vector comprises a nucleotide sequence encoding a linking peptide sequence positioned between the complex secretory signal and hG-CSF protein, said peptide

consisting of two basic amino acids such as Lys-Arg, Lys-Lys, Arg-Lys or Arg-Arg in a manner allowing the signal peptide to be easily cleaved. For example, in case of two basic amino acids being linked, the linkage may be cleaved by KEX2 enzyme.

(8) A process for producing hG-CSF protein according to (7) above, wherein the vector comprises a nucleotide sequence encoding a peptide positioned between the N-terminal of hG-CSF protein sequence and the C-terminal of the complex secretory signal, said peptide consisting of a dipeptide Glu and Ala being repeated not more than six times. The peptide of Glu-Ala should be repeated not more than six times in order for a complete processing upon treating aminopeptidase thereafter. If the peptide is too long, 100% reaction efficiency may not be attained.

(9) A process for producing hG-CSF protein according to (7) above, wherein the vector comprises a nucleotide sequence encoding naturally-occurring yeast a- factor (SEQ ID NO: 45) positioned between the N-terminal of hG-CSF protein sequence and the C-terminal of the complex secretory signal.

(10) A synthetic G-CSF gene, which comprises a nucleotide sequence as shown in SEQ ID NO: 46, wherein yeast preference codons are employed.

(11) A vector for protein expression in yeast (pLES 5), wherein the vector according to (2) above comprises an inducible yeast promoter, a complex secretory signal, a yeast transcription terminator, selection markers, and a yeast replication origin, thereby enhancing the secretion and extracellular expression of secretory recombinant protein. These elements are not particularly limited, and some examples for them have been described as in (5) above.

(12) A vector for protein expression in yeast according to (11) above, wherein the complex secretory signal has a nucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 7.

(13) A vector for protein expression in yeast according to (11) above, wherein the vector comprises a nucleotide sequence encoding a linking peptide sequence

positioned between the complex secretory signal and hG-CSF protein, said peptide being selected from the group consisting of Lys-Arg, Lys-Lys, Arg-Lys and Arg-Arg.

(14) A vector for protein expression in yeast according to (11) above, wherein the vector comprises a nucleotide sequence encoding a peptide positioned between the N-terminal of hG-CSF protein sequence and the C-terminal of the complex secretory signal, said peptide consisting of a dipeptide Glu and Ala being repeated not more than six times.

(15) A vector for yeast expression according to (11) above, wherein the vector comprises a nucleotide sequence encoding naturally-occurring yeast a-factor (SEQ ID NO: 45) positioned between the N-terminal of hG-CSF protein sequence and the C-terminal of said complex secretory signal.

(16) A vector for hG-CSF expression (pLES5 ADH2/GAPDH-hG-CSF) according to any one of (11) to (14), wherein the vector for protein expression in yeast comprises a nucleotide sequence as shown in SEQ ID NO : 46.

(17) A transformed yeast cell (KCTC 10110BP), wherein the vector for hG- CSF expression pLES5 ADH2/GAPDH-hG-CSF according to (16) above is a vector pLES5 ADH2/GAPDH-G01 comprising inu-a-proL-KR (EA) 3-GCSF.

(18) A transformed yeast cell (KCTC 10111BP), wherein the vector for hG- CSF expression pLES5 ADH2/GAPDH-hG-CSF according to (16) above is a vector pLES5 ADH2/GAPDH-G14 comprising inu-a-proL-KR-GCSF.

(19) A transformed yeast cell (KCTC 10112BP), wherein the vector for hG- CSF expression pLES5 ADH2/GAPDH-hG-CSF according to (16) above is a vector pLES5 ADH2/GAPDH-G25 comprising inu-a-proL-KR (EA) 3- (a-factor)-KR- GCSF.

(20) A transformed yeast cell (KCTC 10113BP), wherein the vector for hG- CSF expression pLES5 ADH2/GAPDH-hG-CSF according to (16) above is a vector pLES5 ADH2/GAPDH-G33 comprising a-leader-KR-GCSF.

(21) A process for producing hG-CSF protein by utilizing the yeast cell according to (17) above and removing a portion of the N-terminal of the produced hG- CSF protein by means of aminopeptidase treatment.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS The present invention is described in more detail with reference to the following examples. However, the scope of the present invention is not limited to these.

EXAMPLE 1 : Preparation of complex secretory signal polynucleotides The complex secretory signal polynucleotides were obtained by polymerase chain reaction (hereinafter referred to as'PCR') as set out in Table 1 below.

TABLE 1 PCR Primer Template Inu-a-proL IA1 inul/inu2 None IA2 a Lpro5'/a Lpro3'GMCSF/pYLBC ora-IFN/pYLBC IA3 inu3/a Lpro3'IA2 IA4 inu4/a Lpro3'IA1/IA3 inul : 5'-atgaagttcgcttactctttgttgttgcca-3' (SEQ ID NO: 1) inu2: 5'-gaagcagaaacaccagccaatggcaacaac-3' (SEQ ID NO: 2) inu3: 5'-tttctgcttctgttattaactacaagaga-3' (SEQ ID NO: 3) inu4 (KpnI) : 5'-aaaggtaccatgaagttcgcttactctttg-3' (SEQ ID NO: 4) a Lpro5' : 5'-attaactacaagagagctccagtcaacact-3' (SEQ ID NO: 5) a Lpro3'KR (EA) 3 reverse: 5'-agcttcagcttcagcttctctcttatctaaaga-3' (SEQ ID NO: 6)

The vector designated asa-IFN/pYLBC containing the amino acid sequence of naturally occurring a-factor leader was used as a template to carry out PCR together with a Lpro5'and a Lpro3'primers. The resulting DNA fragment had a nucleotide sequence encoding 66 amino acids in total, which deleted 19 amino acids from the N-terminal of naturally-occurring a-factor leader protein.

The vector designated as GMCSF/pYLBC containing the naturally-occurring a-factor leader amino acid sequence in which serine at the position 42 is substituted with leucine, was used as a template to carry out PCR together with a Lpro5'and a Lpro3'primers. The resulting DNA fragment had a nucleotide sequence encoding 66 amino acids in total, which deleted 19 amino acids from the N-terminal of naturally-occurring a-factor leader protein.

The 1A4 gene obtained above comprises a nucleotide sequence encoding inulinase 1A signal protein of Kluyveromyces marxianus and a nucleotide sequence encoding a part of a-factor leader signal (hereinafter referred to as'pro-a leader') of Saccharomyces cerevisiae. The inulinase 1A protein and pro-a leader protein are linked together through two amino acids lysine-arginine.

The amino acid sequence of the complex secretory signal prepared by the above procedure is as follows: Met-Lys-Phe-Ala-Tyr-Ser-Leu-Leu-Leu-Pro-Leu-Ala-Gly-Val-Ser-Ala-Ser-Val-Ile- Asn-Tyr-Lys-Arg-Ala-Pro-Val-Asn-Thr-Thr-Thr-Glu-Asp-Glu-Thr-Als-Gln-Ile-Pro- Ala-Glu-Ala-Val-Ile-Gly-Tyr-Leu (or Ser)-Asp-Leu-Glu-Gly-Asp-Phe-Asp-Val-Ala- Val-Leu-Pro-Phe-Ser-Asn-Ser-Thr-Asn-Asn-Gly-Leu-Leu-Phe-Ile-Asn-Thr-Thr-Ile- Ala-Ser-Ile-Ala-Ala-Lys-Glu-Glu-Gly-Val-Ser-Leu-Asp-Lys-Arg (SEQ ID NO: 7)

EXAMPLE 2: Preparation of vector for secretion and extracellular expression in yeast The vector (hereinafter referred to as'pLES 5') used in the present invention was constructed in the following manner. pYES 2 (Catalog No. V825-20, Invitrogen, USA) which is a commercially available vector for protein expression in yeast, was used as a template to conduct three amplifications: a part of Ampicillin-ColEl was amplified together with primer set 1; a part of URA3 selection markers origin gene was amplified by using primer set 2; and a part from fl origin to terminator including a multicloning site was amplified by using primer set 3. The resulting amplified DNA fragments were subjected to three pairs of restriction enzymes SalI-SacII, SacII-BglII and BgIII-SalI and then the three DNA fragments were ligated in one reaction by the use of ligase to reconstruct the expression vector designated as pYES 3. pYES 3 is generally the same as pYES 2 in terms of selection marker, promoter and terminator; however, pYES 3 differs from pYES 2 in that the former has additional sites for the action of restriction enzyme, which allows it to be easily modified according to a user's needs.

ADH2/GAP promoter and GAP terminator were amplified using G-CSF expression vector according to Korean Patent Number 0154965 as a template together with primer sets 4 and 5, respectively. The amplified DNA fragments of promoter and terminator were digested with pairs of restriction enzymes BglII-HindlII and XbaI- SalI, and then ligated to 4.5 kb fragment obtained by cleaving pYES 3 with BglII and SalI. The resulting functional yeast expression vector was designated as pLES 5.

The nucleotide sequences of the primer sets used in Example 2 are summarized in Table 2 below.

TABLE 2 Primer set 1 Forward 5'-tatatgagttattacccgcggaaaaaggaagagtat-3' (SEQ ID NO : 8) Reverse 5'-cgaaggctttaatttgtcgacctgcattaatgaatc-3' (SEQ ID NO : 9) Primer set 2 Forward 5'-tatcaaccggggtggagatctccattgcgaataccg-3' (SEQ ID NO : 10) Reverse 5'-atactcttcctttttccgcgggtaataactgatata-3' (SEQ ID NO : 11) Primer set 3 Forward 5'-gattcattaatgcaggtcgacaaattaaagccttcg-3' (SEQ ID NO : 12) Reverse 5'-cggtattcgcaatggagatctccaccccggttgata-3' (SEQ ID NO : 13) Primer set 4 Forward 5'-aaaagatctttcaatatgcgcacatacgc-3' (SEQ ID NO : 14) Reverse 5'-aaaaagcttggtgtttgtttatgtgtgtt-3' (SEQ ID NO : 15) Primer set 5 Forward 5'-aaatctagatcgacttggttgaacacgtt-3' (SEQ ID NO : 16) Reverse 5'-aaagtcgactggtatggttttatcgtttt-3' (SEQ ID NO : 17) EXAMPLE 3: Preparation of human G-CSF gene The recombinant human G-CSF gene (SEQ ID NO: 46) was obtained by carrying out PCR as described in Table 3 below. Hereafter, all the PCR in the present invention were carried out in a manner of 30 seconds at 94°C, 30 seconds at 55°C and 45 seconds at 72°C for 25 cycles, using vent DNA polymerase (Catalog No. 254L, manufactured by New England Biolab, USA).

The complementary sequence of each primer in the primer sets as shown in Table 3 below is underlined.

TABLE 3 PCR Primers Template A Primer 1 and 2 None B Primer 3 and 4 None C Primer 5 and 6 None D Primer 7 and 8 None E Primer 9 and 10 None F Primer 1 and 4 A and B G Primer 5 and 8 C and D H Primer 7 and 10 D and E I Primer 3 and 6 B and C J Primer 1 and 8 F and G K Primer 5 and 10 G and H L Primer 1 and 10 J and K Primer 1 : 5'-actccacttggtcctgcttcttccttaccacaatctttcctccttaaatgtttagaacaagttcgta-3' (SEQ ID NO : 18) Primer 2: 3'-atcttgttcaagcattttaggtcccactgccacggcgagaggttctctttaatacacggtggatgtttaa-5' (SEQ ID NO: 19) Primer 3: 5'-tgccacctacaaattatgtcaccctgaagagctcgttcttttaggtcactccctcggtatcccatgggcc-3' (SEQ ID NO: 20) Primer 4: 3'- ccatagggtacccggggagaaagaaggacaggtagagtccgaaatgttgagcggccaacagaaaggg tca-5' (SEQ ID NO: 21)

Primer 5: 5'-gttgtctttcccagttacactctggtctctttctttaccaaggtttactccaggctcttgaaggtatctc-3' (SEQ ID NO: 22) Primer 6: 3'- agaacttccatagaggggactcaatccaggttgagagctatgggaggttgaactgcaacggctaaagcg a-5' (SEQ ID NO: 23) Primer 7: 5'-gttgccgatttcgctactaccatctggcagcaaatggaagagttaggtatggcccctgctctccagccaa- 3' (SEQ ID NO: 24) Primer 8: 3'- gacgagaggtcggttgagttccacggtacggacgaaaacggagacgaaaggtcgcagcacgaccacc aca-5' (SEQ ID NO: 25) Primer 9: 5'-tcgtgctggtggtgttcttgttgcctcccacttacaatcttttctcgaagtttcctaccgtgttcttcgt-3' (SEQ ID NO: 26) Primer 10: 3'-atggcacaagaagcagtgaatcgggtcggtattatc-5' (SEQ ID NO: 27) EXAMPLE 4: Preparation of yeast secretory G-CSF gene In order to characterize the effect of the complex secretory signal in promoting/enhancing secretion and extracellular expression of G-CSF in yeast, various types of secretory signal sequences linked to G-CSF gene were constructed using PCR method.

TABLE 4 PCR Primers Template a-leader KR-GCSF Al RhGCSF12/rhGCSF 14 HGCSF A2 GMCSF2-5'/rhGCSF13 GMCSF/pYLBC A3 GMCSF2-5'/rhGCSF14 A1/A2 a-leader KR (EA) 3 GCSF B1 RhGCSF11/rhGCSF 14 HGCSF B2 GMCSF2-5'/a Lpro 3'GMCSF/pYLBC B3 GMCSF2-5'/rhGCSF 14 B1/B2 Inu-a-proL-KR (EA) 3 C inu4/rhGCSF 14 IA4/B1 GCSF Inu-a-proL-KR (EA) 3KR- D1 KREAKR5'/rhGCSF 14 HGCSF GCSF D2 inu4/KREAKR 3'C D3 inu4 / rhGCSF 14 D1 /D2 Inu-a-proL-(EA) 3KR- E1 EAKR5'/rhGCF 14 D3 GCSF E2 inu4/EAKR3'C E3 inu4/rhGCF 14 E1/E2 Inu-a-proL-KR-GCSF F1 inu4/a-leader3'C F2 gcsf5'/rhGCF 14 HGCSF F3 inu4 / a L-gcsf3' F1 F4 a L-gcsf5'/rhGCF 14 F2 F5 inu4 / RhGCF 14 F1 / F2 a-leader KR-GCSF G1 a L-Kpn/a-leader3'GMCSF/pYLBC G2 a L-Kpn/a L-gcsf3'Gl _ G3 _ a L-Kpn/rhG-CSF 14 G1/F4 Inu-a-proL-KR (EA) 3- H1 a factor5'/ a factor3' None a Factor-KR-GCSF H2 inu4/a Lpro 3'C H3 gcsf5'/rhG-CSF 14 HGCSF H4 inu4/a factor3'Hl/H2 H5 A factor5'/rhG-CSF 14 H1 / H3 H6 inu4/rhG-CSF 14 H4/H5 rhG-CSF 11 : 5'-aagagagaagctgaagctgaagctactccacttggtcct-3' (SEQ ID NO: 28) KR (EA) 3-GCSF-sense

rhG-CSF 12 : 5'-tctttagataagagaactccacctggtcct-3' (SEQ ID NO: 29) KR-GCSF-sense rhG-CSF 13 : 5'-aggaccaggtggagttctcttatctaaaga-3' (SEQ ID NO: 30) KR-GCSF- reverse rhG-CSF 14 : 5'-aaagaattcctattatggctgggctaagtg-3' (SEQ ID NO: 31) (EcoRI) hGCSF- reverse a Lpro3'KR (EA) 3 reverse: 5'-agcttcagcttcagcttctctcttatctaaaga-3' (SEQ ID NO: 32) GMCSF2-5' (BamHI) : 5'-aaaggatccatgagatttccttcaatttttactgc-3' (SEQ ID NO: 33) KREAKR5' : 5'-gaagctgaagctaaacgtactccacttggtcct-3' (SEQ ID NO: 34) KREAKR3' : 5'-agtacgtttagcttcagcttcagcttctctctt-3' (SEQ ID NO: 35) EAKR5' : 5'-ggggtatctctagatgaagctgaagctgaagctaaacgt-3' (SEQ ID NO: 36) EAKR3' : 5'-acgtttagcttcagcttcagcttcatctagagatacccc-3' (SEQ ID NO: 37) a-leader3' : 5'-atctagagataccccttcttctttagcagc-3' (SEQ ID NO: 38) gcsf5' : 5'-actccacttggtcctgcttcttccttacca-3' (SEQ ID NO: 39) a L-gcsf3' : 5'-agaagcaggaccaagtggagttctcttatctagagatacccc-3' (SEQ ID NO : 40) a L-gcsf5' : 5'-ggggtatctctagataagagaactccacttggtcctgcttct-3' (SEQ ID NO: 41) a L-Kpn (Kpn I): 5'-aaaggtaccatgagatttccttcaatttttactgct-3' (SEQ ID NO: 42) a factor5' : 5'-aagagagaagctgaagctgaagcttggcactggttgcaattgaagccaggtcaaccaatg-3' (SEQ ID NO: 43) a factor3' : 5'-agcaggaccaagtggagttctcttgtacattggttgacctggcttcaattgcaacca-3' (SEQ ID NO: 44) The linkage form of the secretory signal prepared by the above procedure and G-CSF is, for example, as follows: in the case of a-leader KR (EA) 3 GCSF, G-CSF was linked to a naturally occurring a-factor leader (which encodes 85 amino acids in total and the amino acid at position 42 is Ser or Leu) through a linking peptide Glu- Ala-Glu-Ala-Glu-Ala; in the case of inu-a-proL-KR (EA) 3GCSF, G-CSF was linked to the complex secretory signal through a linking peptide Glu-Ala-Glu-Ala-Glu-Ala.

Further, in the case of inu-a-proL-KR (EA) 3KR-GCSF, G-CSF was linked to the complex secretory signal through a linking peptide Glu-Ala-Glu-Ala-Glu-Ala- Lys-Arg. In the case of inu-a-proL- (EA) 3KR-GCSF, G-CSF was linked through the linking peptide Glu-Ala-Glu-Ala-Glu-Ala-Lys-Arg to the complex secretory signal, in which Lys-Arg (amino acids at postions 84 and 85) residues of the carboxyl terminal were removed. In the case of inu-a-proL-KR-GCSF, a complex secretory signal was directly linked to G-CSF. In the case of inu-a-proL-KR (EA) 3- (a-Factor)-KR-G- CSF, G-CSF was linked to the complex secretory signal through a linking peptide Glu-Ala-Glu-Ala-Glu-Ala-Lys-Arg- (a-factor)-Lys-Arg.

The a-factor coding gene used herein comprises a nucleotide sequence responsible for expressing a-factor protein of naturally-occurrring Saccharomyces cerevisiae, and the protein sequence of a-factor is as follows: Trp-His-Trp-Leu-Gln-Leu-Lys-Pro-Gly-Gln-Pro-Met-Tyr (SEQ ID NO: 45) EXAMPLE 5: Construction of G-CSF vector for secretion and extracellular expression in yeast G-CSF vector for secretion and extracellular expression in yeast was constructed by ligating yeast secretory G-CSF genes as listed in Example 4 to pLES 5 by the use of suitable restriction enzymes (KpnI-EcoRI or BamHI-EcoRI) and ligase (Fig. 3).

EXAMPLE 6: Expression and secretion of G-GSF in yeast Each of the G-CSF expression vectors constructed by the above procedure was used to transform yeast (Saccharomyces cerevisiae) in a manner allowing the yeast to express and secrete hG-CSF. The transformed yeast was cultured at 30°C for 48 hours and was centrifuged to collect a supernatant. G-CSF levels in the culture media

was analyzed through SDS-PAGE. The result showed that G-CSF was over- expressed in the case of using expression vectors containing various types of complex secretory signals.

The complex secretory signal sequences, of which expression as recombinant human G-CSF was confirmed, were inu-a-proL-KR (EA) 3-GCSF (the vector pLES5 ADH2/GAPDH-G01 comprising this complex secretory signal, harbored in yeast, was deposited with Gene Bank under the accession No. KCTC 10110BP), inu-a-proL- KR-GCSF (the vector pLES5 ADH2/GAPDH-G14 comprising this complex secretory signal, harbored in yeast, was deposited with Gene Bank under the accession No.

KCTC 10111BP), a-leader-KR-GCSF (the vector pLES5 ADH2/GAPDH-G33 comprising this complex secretory signal, harbored in yeast, was deposited with Gene Bank under the accession No. KCTC 10113BP) and inu-a-proL-KR (EA)-3- (a- factor)-KR-GCSF (the vector pLES5 ADH2/GAPDH-G25 comprising this complex secretory signal, harbored in yeast, was deposited with Gene Bank under the accession No. KCTC 10112BP) (Fig. 4).

Among the above constructs, G-CSF expression vectors possessing complex secretory signal structures of inu-a-proL-KR-GCSF, a-leader-KR-GCSF, and inu- a-proL-KR (EA)-3- (a-factor)-KR-GCSF were confirmed to produce G-CSF having the same molecular weight as that of naturally-occurring forms, and the sequence analysis of the amino terminal revealed that resulting G-CSF had the same amino acid sequence as that of naturally-occurring forms. This proves that the removal of leader peptide after translation of protein was successfully accomplished (Fig. 5).

It was also confirmed that among the vector constructs which were confirmed to produce G-CSF having the same molecular weight as that of naturally-occurring forms, inu-a-proL-KR-GCSF and inu-a-proL-KR (EA)-3- (a-factor)-KR-GCSF

having the complex secretory signal structure, in which inu sequence was added, showed more efficient expression and secretion of recombinant G-CSF as compared to those of inu-leader-KR-GCSF not having the inu sequence (Fig. 4).

Furthermore, it was also confirmed that vectors comprising inu-a-proL- KR (EA) 3-GCSF showed much better expression and secretion of recombinant G-CSF as compared to those of vectors not having the inu sequence. The expression level of recombinant G-CSF by these vectors was 30-50 mg/liter, a considerably high level.- Among the complex secretory signal structures of which recombinant human G-CSF expression was confirmed, the expression vector having inu-a-proL- KR (EA) 3-GCSF was confirmed to produce a protein having a molecular weight higher than that of naturally-occurring forms (Fig. 4). The sequence analysis of N- terminal of the resulting protein revealed that the resulting G-CSF had an additional amino acid sequence EAEAEA at the amino terminal of naturally-occurring G-CSF (Fig. 5).

The six amino acids added to the N-terminal may be removed by aminopeptidase treatment as shown below.

EXAMPLE 7: Removal of foreign amino terminal amino acids by the use of aminopeptidase Aminopeptidase isolated and purified from Bacillus licheniformis was employed to remove six amino acids added to the N-terminal of G-CSF which was produced from the expression vector comprising inu-a-proL-KR (EA) 3-GCSF among the complex secretory signal structures from which recombinant human G-CSF expression was confirmed. The titer and concentration of aminopeptidase used in the processing was 1171 U/mg and 2.13 mg/ml, respectively.

The removal of foreign peptide of N-terminal was carried out by concentrating the culture medium, adjusting pH and salt concentration to pH 8.2 and 50 mM Tris, respectively, adding aminopeptidase in an amount of 2 ml/100ml (concentrated culture medium), and reacting at 37°C for 23 hours. After the completion of the reaction, the reaction solution was primarily subjected to dialysis at 37°C for 23 hours against 100 mM NaCI, 50 mM Tris, pH 7.0 buffer, and then was secondarily subjected to dialysis at 37°C for 23 hours against 100 mM NaCI, 50 mM Tris, pH 8.5 buffer.

N-terminal analysis was conducted on EAEAEA-G-CSF, in which the N- terminal had been subjected to aminopeptidase treatment. As a result, it was confirmed that aminopeptidase treatment removed only six excess amino acids at the N-terminal and thus produced naturally occurring human G-CSF. In a standard experiment using naturally occurring G-CSF, it was found that aminopeptidase did not digest the N-terminal of naturally occurring G-CSF.

EXAMPLE 8: Identification and analysis of yeast secretory human G-CSF In order to identify the yeast secretory recombinant human G-CSF obtained as above, the protein isolated and purified from the culture medium was completely digested with trypsin, and then peaks were analyzed through MALDI-TOF mass spectrophotometer analysis. The results were input to a computer and compared with the peak data of protein digested with trypsin, being obtained from the NCBI (National Center for Biotechnology Information) (Fig. 6).

Furthermore, the total mass of yeast secretory recombinant human G-CSF was measured by mass spectrometry, by which it could be determined whether or not the yeast secretory recombinant human G-CSF of the present invention were glycosylated.

As a result, the total mass of the yeast secretory recombinant human G-CSF of the

present invention was 18667.7, which exactly coincided with the theoretical total mass of human G-CSF of naturally occurring forms (Fig. 7).

The fact that the yeast secretory recombinant human G-CSF according to the present invention was not glycosylated was reconfirmed using Glycan Detection Kit (Catalog No. 1142372, manufactured by Roche Co. ) (Fig. 8).

EXAMPLE 9: Titration of yeast secretory human G-CSF through in vitro analysis The titer of the yeast secretory recombinant human G-CSF of the present invention was measured by in vitro analysis using human promyelocytic HL-60 cells (Biol. Pharm. Bull. 20 (9) 943-947 (1997) ). As a result, the titer of the yeast secretory recombinant human G-CSF of the present invention was found to be more than 1. 5E+08 IU/mg. This value was conspicuously higher than l. OE+08 IU/mg, which is the titer of G-CSF commercially available from Amgen Inc. , or 1.2. 8E+08 IU/mg, which is the titer of G-CSF commercially available from Chugai Kabushiki Kaisha.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 shows a novel gene nucleotide sequence encoding naturally-occurring human G-CSF, which is designed to optimize the expression of the protein in yeast and which is synthesized by PCR.

Fig. 2 shows the amino acid sequence of a novel complex secretory signal expressed by the nucleotide sequence of Fig. 1.

Fig. 3 shows a map illustrating the structure of pLES5 ADH2/GAPDH hG- CSF vector.

Fig. 4 shows a photograph illustrating the level of secretion and extracellular expression of the recombinant human G-CSF in yeast which is transformed with

pLES5 ADH2/GAPDH hG-CSF vectors containing different complex secretory signals, through SDS-PAGE.

Fig. 5 shows the analysis results of amino terminal sequence of G-CSF expressed and secreted by yeast which is transformed with pLES5 ADH2/GAPDH hG-CSF vectors containing different complex secretory signals.

Fig. 6 shows the analysis results of MALDI-TOF mass spectrophotometer of G-CSF expressed and secreted by yeast which is transformed with pLES5 ADH2/GAPDH hG-CSF vector.

Fig. 7 shows the results of total mass analysis of G-CSF expressed and secreted by yeast which is transformed with pLES5 ADH2/GAPDH hG-CSF vector.

Fig. 8 shows the results of sugar chain analysis of G-CSF expressed and secreted by yeast which is transformed with pLES5 ADH2/GAPDH hG-CSF vector.

INDUSTRIAL APPLICABILITY As described above, the yeast secretory recombinant human G-CSF of the present invention, expressed by the use of yeast transformed with yeast secretory human granulocyte colony stimulating factor expression vector pLES5 ADH2/GAPDH-hG-CSF, has the same amino acid sequence as that of naturally occurring forms. Further, the yeast secretory recombinant human G-CSF of the present invention is free of contamination with endotoxins in its purification procedures, as compared to G-CSF produced by E. coli, and is free of association with virus or prions, which was a problem of production in animal cells. Also, the yeast secretory recombinant human G-CSF of the present invention has medicinally available high titer value, and thus is ideal to be commercialized to treat diseases. In addition, the expression and secretion level of G-CSF expression vector comprising a complex secretory sequence of yeast including inu sequence was found to be much higher than that of G-CSF expression vector comprising the existing yeast secretory

sequence. In sum, the present invention is extremely valuable in view of the facts that it pertains to a process for producing a secretory recombinant protein, which is characterized by enabling the mass production of G-CSF, and the efficiency of the whole production procedure is enhanced, to a yeast expression vectors used therefor, and to a transformed yeast cell.

INTERNATIONAL FORM RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 TO : SUNG. Jae Kap LOCI Ltd.

#104-), Moonji-dong, Yuseong" gu, Daejeon 305-380, Republic of Korea Cr.'. : . x a ; ttti'.-iven r s . ld : CiCGatiart rerrc givn by ci KCTC 101, 14) BP OEPOsmm.. AUtHOry : u P, N AND/OP, MPOSED pMHM'MMm KTIOMF m The CCEHTMC DETI AND/OK PROPOSED TONOMK : B6NAHON ! The'mMfMtamSM MenS ! aader ! above was acMpattM ty :' ' ! x' ! a seiMttSc scdption j C j a pMpQasd taxof ; c'M ! C dH2 {H-614 | 1 Bp pL ! FS5 ADH2/GAPIDR-GI4 KCTC 1, 01118P. t . SG : 1 : 'x'TF'IG. LSGRt.'I R PEtQPOSE T : . . V., jT. The microorganism identied under I above was accompatusd by : C x I a scientific desoptioti - [] « proposed taxowotnic designatmn (Mark with a cross where applicable) L m, RECEIPT AND ACCEPTANCE This International Depositary Authority accepts the micrptganasm : adenrfied ttnder f bove, which w. as received by it on November 09 2001. . RECEtPTOF, EEOUEST FOR CONVERSfON off The microorganism idenCified under I above was received by this Ittternacionl IpoS (tary iitid a request. to convert thp onginal deposìr so a deposit j under che Budapesc Treaty was t'eceivec ! by ? on h---------------------------------------------- y, TRNATtOb ? AL DEPOSITARY AUTHORn'Y,, Name : Korean £oltectfon fof lFype Cultulles Sienåtul' (s) of personEs) havin£ the power 4 to prnt the tatrnatonal 7ep4sitarY Authority of authorized ofScia)

#104-1. Moonji-dong, Yuseong-gu, Daejeon, 305-380, Republic of Korea , i,., , . 1. _ HendQeatioA fermee aiwn hv rhf Accession nmmbar. gtVCn by d) 0 INTERNATIONAL DEPOSITARY A'dI'"' :. cAycceMNme ,. . , 9Q AUrIlORITY-,." Sacchommyeas rereuis IKCTC 10112B) P ! AND/ The, x jf a scRdSc [on. t x} a sclenW se>ion C a mxorkgrrc de ! ; i4tation ' (Wk wtth at cross where appticabh) HE. RECEIPT. ; E *,.. . This ttitemsaa DepcsKy Aa&caty eepts the MMCtstn ndeaSe er H abce. i wMch. as teceM by it co. Novembey ( ! 9 OSt., . T t7t G The tnicrcofgaatM tdtMJiM-tmer abovs waa Mcet by dus Inmcnat ! D< ! p< ! s ! t !"y ß Authoncv on and a request ? coDMt the onginat deport ? a deposit under the Budapest Treaty was received by it on 1i. ItV'' : tN, r"ACI'1SITA'', , TI _ _ __.. Name, Korean CoXatOft tor Type CuHus 5 ! gM ! BM jp
isued pursuant to Rule 7.1
TO : SUNG, Jae Kap LGCI Ltd.

#104-1, Moonji-dong, Yuseong-gu, Daejeon 305-380, Republic of Korea INTERNATIONAL FORM RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Ruk 7, 1 SUNG, Jae Kap LGCI Ltd.

#104-1, Moonji-dong, Yuseong-gu, Daejeon 305-380, Republic of Korea § IDENTMCAftON OF THE MIGROGRGAMSM ,. : RITERNATIONAL. fP ? Xt ? R'. TERJSiA', tCltAT.. 1FJSITtC' At'THC1TY *% 5 Rt/MP%-GS3. 1 ;. 1Q$ : t3 ». of,-M5 ADla2/e-APOYI-G33 SCi"IFI aCit Iy l0 'tt7 I TiIX NQri' Gt The microorganism identified under I above was accompanied by : (x) a sei. tific description j f J a proposed taxonon) ic designation (Mark wttha cross where appUcabte) M. R) ECET"- A. M.--ACCEPTAI This Internatioaal Depositary Authority accepts the dcrorearsm identified under I above, which was received by it on ivembef 69 20tH. IYR 0PT OF RgOWsR 4gR$10N _ _ _ _ _ _. f The mi¢torganism identified under I above was received by this Interiational Deposit Authod on and a request to convert the oriifirw deposit t a post under th ? RMapest Trey was Teceived by ? on. V. tNTEnNATIONAL DEPOSITARY AUTHORITY. am Kofean Gotiectton fQf Type CttUfes SignatH !'6ate : November 15 20ol. l