Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

class Solution {
public:
    int charToInt(char s)
    {
	    switch (s)
	    {
		    case 'A':
			    return 0;
		    case 'C':
			    return 1;
		    case 'G':
			    return 2;
		    case 'T':
			    return 3;
	    }
    }
    
    vector<string> findRepeatedDnaSequences(string s) {
        vector<string> result;
	    int maxNum = 1024*1024/8;
	    int num = maxNum/sizeof(unsigned int);
	    unsigned int found[num];
	    unsigned int outputed[num];
	    memset(found, 0, maxNum);
	    memset(outputed, 0, maxNum);

	    unsigned int sequence = 0;
	    int i = 0;
	    for (; i < 9; i++)
	    {
		    sequence |= charToInt(s[i]);
		    sequence <<= 2;
	    }

	    int bitLen = 8 * sizeof(unsigned int);
	    int len = s.length();
	    for (; i < len; i++)
	    {
		    sequence |= charToInt(s[i]);
		    sequence &= 0xFFFFF;
		    int pos = sequence / bitLen;
		    int offset = sequence % bitLen;
		    unsigned int label = 1 << offset;
		    if ((found[pos] & label) == 0)
		    {
			    found[pos] |= label;
		    }
		    else
		    {
			    if ((outputed[pos] & label) == 0)
			    {
				    outputed[pos] |= label;
				    result.push_back(s.substr(i-9, 10));
			    }
		    }

		    sequence <<= 2;
	    }

	    return result;
    }
};