LeetCode #187: Repeated DNA Sequences

Problem Statement

(Source) All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: “ACGAATTCCG”. When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

Solution

Naive first:

class Solution(object):
    def findRepeatedDnaSequences(self, s):
        """
        :type s: str
        :rtype: List[str]
        """
        if not s:
            return []

        n = len(s)
        if n < 11:
            return []

        res = set()
        dic = {}
        for i in range(n - 9):
            sub = s[i : i + 10]
            if sub not in dic:
                dic[sub] = 1
            else:
                res.add(sub)

        return list(res)

Tweak it a little bit:

class Solution(object):
    def findRepeatedDnaSequences(self, s):
        """
        :type s: str
        :rtype: List[str]
        """
        if not s:
            return []

        n = len(s)
        if n < 11:
            return []

        res = []
        dic = {}
        for i in range(n - 9):
            sub = s[i : i + 10]
            dic[sub] = dic.get(sub, 0) + 1
            if dic[sub] == 2:
                res.append(sub)
        return res

Final solution using Bit Manipulation to save space by converting strings to integers:

class Solution(object):
    def findRepeatedDnaSequences(self, s):
        """
        :type s: str
        :rtype: List[str]
        """
        n = len(s)
        if n <= 10:
            return []

        res = []
        y = 0
        m = {'A': 0, 'C': 1, 'G': 2, 'T': 3}
        counter = dict()
        for i in xrange(n):
            y = (y * 4 + m[s[i]]) & 0xFFFFF
            if i < 9:
                continue
            counter[y] = counter.get(y, 0) + 1
            if counter[y] == 2:
                res.append(s[i - 9 : i + 1])

        return res