html表单logo,WebLogo - Logo Form Help

Enter your sequence information here. There are three formats to choose from;

FASTA, CLUSTALW, and flat.

In all cases, lines beginning with "#" are comment lines

and have no effect on the output logo. All sequences must be the same length.

>name1 (optional)

acgtacgtacgtacgtacgattca

>name2 (optional)

tacgtacgatcgatcgtgactacg

>name3 (optional)

actgactagctactagctactacg

...

>nameN (optional)

actgactagctagcatcgactgac

name1line1 atcgagttatcgcgaggagaggcgcgtacgatcgatcgatcgatgcatgcatcgatcgatgctataatacgatgctagca

name2line1 tacgtacgatcgatcgtgactacgactgatcgatgcatcgatgctagctagctagctagctagctagcatgctagctagc

...

nameNline1 actgactagctagcatcgactgacactgactgactgatcgatcgatcgatcgatcgatcgatcgatcgatcgtagtagtg

name1line2 atgcatcgacacacatgtgtgatcattatagagcgctagcatgcatgctagatcgtacgtacgtacgtacgtacgattca

name2line2 tacgtacgatcgatcgtgactacgatgcatgcatcgcggatatatagagagatctatcgcatcgatcgatcgatcgatcg

... atcgagttatcgcgaggagaggcgcgtacgatcgatcgatcgatgcatgcatcgatcgatgctataatacgatgctagca

nameNline2 actgactagctagcatcgactgacatcgatcgatcgatcgatcgatcgatcgatcgatcgatcgatcgatgctagctagc

...

...

name1lineM acgtacgtacgtacgtacg

name2lineM tacgtacgatcgatcgtga

...

nameNlineM actgactagctagcatcga

sequence1

sequence2

sequence3

...

sequenceN

Sequence data can be of "amino acid" or "DNA/RNA". Choose

"Automatic Detection" to have Weblogo choose for you, based on the entered

data (if 90% or more of the entered data are a, c, t or g residues, then

Weblogo chooses DNA/RNA.

Choose this option to label the 5' & 3' ends of nucleic acid or

the N & C termini of amino acid sequences.

The numerical label of the first residue in the multiple sequence alignment.

The label must be an integer.

Residue labels for the logo will be relative to this number.

(See also: Logo Range)

By default, all sequence data is displayed in the Sequence Logo. With

this option, you can instead show a subrange of the entire sequence. Start

and end positions are included,

and the numbering of positions is relative to the sequence number of the

first position. (See also: First Position Number )

Thus, if the first position number is "2", start is "5" and end is "10", then

the 4th through 9th (inclusive) sequence positions will be displayed, and

they will be numbered "5", "6", "7", "8", "9" and "10".

Show residue frequencies, rather than information content.

When there are only a few sample sequences a straightforward calculation

will tend to overestimate the entropy. To compensate, this option will

subtract an approximation of this bias from the total entropy.

This small sample correction depends only

on the number of symbol types (4 for RNA/DNA, 20 for protein) and

the total amount of data in each column, which may differ from

one column to another, since some columns will contain more gaps,

and less data.

A multiline Logo will split the sequence across several lines, instead of

cramming

all of the sequence within the single line width specified above.

The Logo height specified at the top of the form becomes

the height of each Logo line.

The number of logo characters per line can be specified.

The total height of the error bar is twice the small sample correction.

The logo can be output in several formats. The following are currently

supported:

EPS : Adobe Encapsulated PostScript

GIF : CompuServe Graphics Interchange Format

PNG : Portable Network Graphics

PDF : Adobe Portable Document Format

Generally speaking, vector formats (EPS and PDF) are better for printing,

while bitmaps (GIF and PNG) are more suitable for displaying on the screen, or

embedding into a web page.

Physical dimensions of output logo in centimeters, inches, pixels, or points.

Typical values are 72 pixels/inch for screen display under Mac OS,

96 pixels/inch for screen display under Windows and 300 or 600

pixels/inch for output to a laser printer.

Antialiasing smoothes the rough edges on a bitmap. You may wish to disable

this feature if, for example, you intend to further edit the bitmap.

Title

Give your logo a title.

Specify the number of bits on the y axis.

By default, the height of the y-axis is

the maximum entropy for the given sequence type.

(log2 4 = 2 bits for DNA/RNA,

log2 20 = 4.3 bits for protein.)

The vertical axis indicates the information content of a

sequence position, in bits. Use this option to toggle the y-axis

and its bit labels.

Give your y-axis a name. The default label for the y-axis is "bits".

The horizontal axis indicates the residue number. Use this option to

toggle the x-axis and its labels.

Customize your x-axis's label. The default is no label.

It is sometimes useful to outline logo residues with boxes. Use the

the shrink factor to decrease the residue size by the factor specified.

The default shrink factor is 0.5,

meaning halve the residue size.

By default, the logo residues are filled. Use this option to get outlined

(non-filled) residues.

The default colors for nucleic acids are

G, orange; T & U, red; C, blue; and A, green.

Amino acids are colored according to their chemical

properties: polar amino acids (G,S,T,Y,C,Q,N) are green,

basic (K,R,H) blue, acidic (D,E) red and

hydrophobic (A,V,L,I,P,W,F,M) amino acids are black.

Alternatively, the Black & White option will color

all symbols black, or the default color scheme can be

overridden with the custom colors specified below.

Specify the residue letters here. The symbols are case insensitive.

No repeated residues are allowed.

Choose the color to give the residues specified in "Symbols". Use the drop-down list to:

* choose a pre-defined color (Black, Red, Green,

Blue, Yellow, Purple, or Orange) or

* choose "RGB=>" and specify an appropriate RGB

color in the "RGB" field.

If you chose "RGB=>" in the "Colors" field,

specify standard hexadecimal colors here

(e. g. FF0000 for pure red, 006666 for Slashdot green).