187. Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

思路：HashMap<String,int> <substring, repeatTimes>

public class Solution {
    public List<String> findRepeatedDnaSequences(String s) {
        List<String> result = new ArrayList<String>();
        int seq_len = 10;
        if(s==null||s.length()<seq_len) return result;
        HashMap<String,Integer> strList = new HashMap<String,Integer>(s.length());
        for(int j=0;j<=s.length()-seq_len;j++){
            String curstr = s.substring(j,j+seq_len);
            if(strList.containsKey(curstr)){
                strList.put(curstr, strList.get(curstr)+1);
            }
            else{
                strList.put(curstr, 1);
            }
        }
        findRepeatedSeq(result, strList);
        return result;
    }
    public void findRepeatedSeq(List<String> result, HashMap<String,Integer> strList){
      Set set = strList.entrySet();
      // Get an iterator
      Iterator i = set.iterator();
      
      // Display elements
      while(i.hasNext()) {
         Map.Entry me = (Map.Entry)i.next();
         if((int) me.getValue()>1) result.add((String)me.getKey());
      }
    }
}