[LeetCode]187. Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

Solution: Create a dictionary to store any sequence with occurrence times.

Running Time: O(n)

class Solution:
    # @param {string} s
    # @return {string[]}
    def findRepeatedDnaSequences(self, s):
        resultDict = {}
        length = len(s)
        i = 0
        while i <= len(s) - 10:
            if s[i: i+10] not in resultDict:
                resultDict[s[i:i+10]] = 1
            else:
                resultDict[s[i:i+10]] += 1
            i += 1
        return [k for k, v in resultDict.iteritems() if v >= 2]