linux中fq格式转fa,Perl:FastQ与FastA格式的相互转换

#!/usr/local/bin/

# Author: lh3

use strict;

use warnings;

use Getopt::Std;

my $usage = qq(

Usage: fq_all2std.pl

Command: scarf2std Convert SCARF format to the standard/Sanger FASTQ

fqint2std Convert FASTQ-int format to the standard/Sanger FASTQ

sol2std Convert Solexa/Illumina FASTQ to the standard FASTQ

fa2std Convert FASTA to the standard FASTQ

fq2fa Convert various FASTQ-like format to FASTA

instruction Explanation to different format

example Show examples of various formats

Note: Read/quality sequences MUST be presented in one line.

\n);

die($usage) if (@ARGV < 1);

# Solexa->Sanger quality conversion table

my @conv_table;

for (-64..64) {

$conv_table[$_+64] = chr(int(33 + 10*log(1+10**($_/10.0))/log(10)+.499));

}

# parsing command line

my $cmd = shift;

my %cmd_hash = (scarf2std=>\&scarf2std, fqint2std=>\&fqint2std, sol2std=>\&sol2std, fa2std=>\&fa2std,

fq2fa=>\&fq2fa, example=>\&example, instruction=>\&instruction);

if (defined($cmd_hash{$cmd})) {

&{$cmd_hash{$cmd}};

} else {

die(“** Unrecognized command $cmd”);

}

sub fa2std {

my %opts = (q=>25);

getopts(‘q:’, \%opts);

my $q = chr($opts{q} + 33);

warn(“– The default quality is set to $opts{q}. Use ‘-q’ at the command line to change the default.\n”);

while (<>) {

if (/^>(\S+)/) {

print “\@$1\n”;

$_ = <>;

print “$_+\n”, $q x (length($_)-1), “\n”;

}

}

}

sub fq2fa {

while (<>) {

if (/^@(\S+)/) {

print “>$1\n”;

$_ = <>; print;

<>; <>;

}

}

}

sub scarf2std {

while (<>) {

my @t = split(‘:’, $_);

my $

sub fqint2std {

while (<>) {

if (/^@/) {

print;

$_ = <>; print; $_ = <>; $_ = <>;

my @t = split;

my $qual = ”;

$qual .= $conv_table[$_+64] for (@t);

print “+\n$qual\n”;

}

}

}

sub sol2std {

my $max = 0;

while (<>) {

if (/^@/) {

print;

$_ = <>; print; $_ = <>; $_ = <>;

my @t = split(”, $_);

my $qual = ”;

$qual .= $conv_table[ord($_)] for (@t);

print “+\n$qual\n”;

}

}

}

sub instruction {

print ”

FASTQ format is first used in the Sanger Institute, and therefore

we take the Sanger specification as the standard FASTQ. Although

Solexa/Illumina reads file looks pretty much like the standard

FASTQ, they are different in that the qualities are scaled

differently. In the quality string, if you can see a character

with its ASCII code higher than 90, probably your file is in the

Solexa/Illumina format.

Sometimes we also use an integer, instead of a single character,

to explicitly show the qualities. In that case, negative

qualities indicates that Solexa/Illumina qualities are used.

“;

}

sub example {

my $exam_scarf = ‘

USI-EAS50_1:4:2:710:120:GTCAAAGTAATAATAGGAGATTTGAGCTATTT:23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 19 23 23 23 18 23 23 23

USI-EAS50_1:4:2:690:87:GTTTTTTTTTTTCTTTCCATTAATTTCCCTTT:23 23 23 23 23 23 23 23 23 23 23 23 12 23 23 23 23 23 16 23 23 9 18 23 23 23 12 23 18 23 23 23

USI-EAS50_1:4:2:709:32:GAGAAGTCAAACCTGTGTTAGAAATTTTATAC:23 23 23 23 23 23 23 23 20 23 23 23 23 23 23 23 23 23 23 23 23 12 23 18 23 23 23 23 23 23 23 23

USI-EAS50_1:4:2:886:890:GCTTATTTAAAAATTTACTTGGGGTTGTCTTT:23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23

USI-EAS50_1:4:2:682:91:GGGTTTCTAGACTAAAGGGATTTAACAAGTTT:23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 20 23 23 23 23 23 23 23 23 23 23 23 18 23 23 23 23

USI-EAS50_1:4:2:663:928:GAATTTGTTTGAAGAGTGTCATGGTCAGATCT:23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23

‘;

my $exam_fqint = ‘

@4_1_912_360

AAGGGGCTAGAGAAACACGTAATGAAGGGAGGACTC

+4_1_912_360

40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 21 40 40 40 40 40 40 40 40 40 26 40 40 14 39 40 40

@4_1_54_483

TAATAAATGTGCTTCCTTGATGCATGTGCTATGATT

+4_1_54_483

40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 40 40 40 28 40 40 40 40 40 40 16 40 40 5 40 40

@4_1_537_334

ATTGATGATGCTGTGCACCTAGCAAGAAGTTGCATA

+4_1_537_334

40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 21 29 40 40 33 40 40 33 40 40 33 31 40 40 40 40 18 26 40 -2

@4_1_920_361

AACGGCACAATCCAGGTTGATGCCTACGGCGGGTAC

+4_1_920_361

40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 40 40 40 40 40 40 40 40 31 40 40 40 40 40 40 15 5 -1 3

@4_1_784_155

AATGCATGCTTCGAATGGCATTCTCTTCAATCACGA

+4_1_784_155

40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 31 40 40 40 40 40

@4_1_595_150

AAAGACGTGGCCAGATGGGTGGCCAAGTGCCCGACT

+4_1_595_150

40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 40 40 40 40 40 40 40 40 40 20 40 40 40 40 40 14 40 40

‘;

my $exam_sol = ‘

@SLXA-B3_649_FC8437_R1_1_1_610_79

GATGTGCAATACCTTTGTAGAGGAA

+SLXA-B3_649_FC8437_R1_1_1_610_79

YYYYYYYYYYYYYYYYYYWYWYYSU

@SLXA-B3_649_FC8437_R1_1_1_397_389

GGTTTGAGAAAGAGAAATGAGATAA

+SLXA-B3_649_FC8437_R1_1_1_397_389

YYYYYYYYYWYYYYWWYYYWYWYWW

@SLXA-B3_649_FC8437_R1_1_1_850_123

GAGGGTGTTGATCATGATGATGGCG

+SLXA-B3_649_FC8437_R1_1_1_850_123

YYYYYYYYYYYYYWYYWYYSYYYSY

@SLXA-B3_649_FC8437_R1_1_1_362_549

GGAAACAAAGTTTTTCTCAACATAG

+SLXA-B3_649_FC8437_R1_1_1_362_549

YYYYYYYYYYYYYYYYYYWWWWYWY

@SLXA-B3_649_FC8437_R1_1_1_183_714

GTATTATTTAATGGCATACACTCAA

+SLXA-B3_649_FC8437_R1_1_1_183_714

YYYYYYYYYYWYYYYWYWWUWWWQQ

‘;

print qq(

solexa

======

$exam_sol

scarf

=====

$exam_scarf

fqint

=====

$exam_fqint

);

}