环境:
adam-2.10.0.19
clean package
test
install
1.Ubuntu下对adam进行mvn clean package -DskipTests
xubo@xubo:~/cloud/adam-2.10-0.19-git$ mvn clean package -DskipTests
[INFO] Scanning for projects...
[INFO] ------------------------------------------------------------------------
[INFO] Reactor Build Order:
[INFO]
[INFO] ADAM_2.10
[INFO] ADAM_2.10: Core
[INFO] ADAM_2.10: APIs for Java
[INFO] ADAM_2.10: CLI
[INFO]
[INFO] ------------------------------------------------------------------------
[INFO] Building ADAM_2.10 0.19.0
[INFO] ------------------------------------------------------------------------
[INFO]
[INFO] --- maven-clean-plugin:2.6.1:clean (default-clean) @ adam-parent_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-parent_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-parent_2.10 ---
[INFO]
[INFO] --- scalariform-maven-plugin:0.1.4:format (default-cli) @ adam-parent_2.10 ---
[INFO] Modified 0 of 199 .scala files
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:compile (scala-compile-first) @ adam-parent_2.10 ---
[INFO] No sources to compile
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:testCompile (scala-test-compile-first) @ adam-parent_2.10 ---
[INFO] No sources to compile
[INFO]
[INFO] ------------------------------------------------------------------------
[INFO] Building ADAM_2.10: Core 0.19.0
[INFO] ------------------------------------------------------------------------
[INFO]
[INFO] --- maven-clean-plugin:2.6.1:clean (default-clean) @ adam-core_2.10 ---
[INFO] Deleting /home/xubo/cloud/adam-2.10-0.19-git/adam-core/target
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-core_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-core_2.10 ---
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-source (add-source) @ adam-core_2.10 ---
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/main/scala added.
[INFO]
[INFO] --- scalariform-maven-plugin:0.1.4:format (default-cli) @ adam-core_2.10 ---
[INFO] Modified 0 of 159 .scala files
[INFO]
[INFO] --- maven-resources-plugin:2.7:resources (default-resources) @ adam-core_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 1 resource
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:compile (scala-compile-first) @ adam-core_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-metrics_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-io_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-cli_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.scoverage:scalac-scoverage-plugin_2.10:1.1.1 requires scala version: 2.10.4
[WARNING] org.bdgenomics.adam:adam-core_2.10:0.19.0 requires scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/main/java:-1: info: compiling
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/main/scala:-1: info: compiling
[INFO] Compiling 108 source files to /home/xubo/cloud/adam-2.10-0.19-git/adam-core/target/scala-2.10.4/classes at 1463194196606
[WARNING] warning: there were 37 deprecation warning(s); re-run with -deprecation for details
[WARNING] warning: there were 33 feature warning(s); re-run with -feature for details
[WARNING] two warnings found
[INFO] prepare-compile in 0 s
[INFO] compile in 57 s
[INFO]
[INFO] --- maven-compiler-plugin:3.3:compile (default-compile) @ adam-core_2.10 ---
[INFO] Changes detected - recompiling the module!
[INFO] Compiling 2 source files to /home/xubo/cloud/adam-2.10-0.19-git/adam-core/target/scala-2.10.4/classes
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-test-source (add-test-source) @ adam-core_2.10 ---
[INFO] Test Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/test/scala added.
[INFO]
[INFO] --- maven-resources-plugin:2.7:testResources (default-testResources) @ adam-core_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 65 resources
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:testCompile (scala-test-compile-first) @ adam-core_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-metrics_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-io_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-cli_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.scoverage:scalac-scoverage-plugin_2.10:1.1.1 requires scala version: 2.10.4
[WARNING] org.bdgenomics.adam:adam-core_2.10:0.19.0 requires scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/test/scala:-1: info: compiling
[INFO] Compiling 53 source files to /home/xubo/cloud/adam-2.10-0.19-git/adam-core/target/scala-2.10.4/test-classes at 1463194259111
[WARNING] /home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/test/scala/org/bdgenomics/adam/rdd/read/recalibration/BaseQualityRecalibrationSuite.scala:38: warning: object DecadentRead in package rich is deprecated: Use RichAlignmentRecord wherever possible in new development.
[WARNING] val bqsr = new BaseQualityRecalibration(cloy(reads), snps)
[WARNING] ^
[WARNING] /home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/test/scala/org/bdgenomics/adam/rdd/read/recalibration/BaseQualityRecalibrationSuite.scala:58: warning: object DecadentRead in package rich is deprecated: Use RichAlignmentRecord wherever possible in new development.
[WARNING] val bqsr = new BaseQualityRecalibration(cloy(reads), snps)
[WARNING] ^
[WARNING] warning: there were 1 feature warning(s); re-run with -feature for details
[WARNING] three warnings found
[INFO] prepare-compile in 0 s
[INFO] compile in 59 s
[INFO]
[INFO] --- maven-compiler-plugin:3.3:testCompile (default-testCompile) @ adam-core_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-surefire-plugin:2.18.1:test (default-test) @ adam-core_2.10 ---
[INFO] Tests are skipped.
[INFO]
[INFO] --- scalatest-maven-plugin:1.0:test (test) @ adam-core_2.10 ---
[INFO] Tests are skipped.
[INFO]
[INFO] --- maven-jar-plugin:2.6:jar (default-jar) @ adam-core_2.10 ---
[INFO] Building jar: /home/xubo/cloud/adam-2.10-0.19-git/adam-core/target/adam-core_2.10-0.19.0.jar
[INFO]
[INFO] --- maven-jar-plugin:2.6:test-jar (default) @ adam-core_2.10 ---
[INFO] Building jar: /home/xubo/cloud/adam-2.10-0.19-git/adam-core/target/adam-core_2.10-0.19.0-tests.jar
[INFO]
[INFO] ------------------------------------------------------------------------
[INFO] Building ADAM_2.10: APIs for Java 0.19.0
[INFO] ------------------------------------------------------------------------
[INFO]
[INFO] --- maven-clean-plugin:2.6.1:clean (default-clean) @ adam-apis_2.10 ---
[INFO] Deleting /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/target
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-apis_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-apis_2.10 ---
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-source (add-source) @ adam-apis_2.10 ---
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/main/scala added.
[INFO]
[INFO] --- scalariform-maven-plugin:0.1.4:format (default-cli) @ adam-apis_2.10 ---
[INFO] Modified 0 of 4 .scala files
[INFO]
[INFO] --- maven-resources-plugin:2.7:resources (default-resources) @ adam-apis_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] skip non existing resourceDirectory /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/main/resources
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:compile (scala-compile-first) @ adam-apis_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/main/scala:-1: info: compiling
[INFO] Compiling 3 source files to /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/target/scala-2.10.4/classes at 1463194321294
[WARNING] warning: there were 2 feature warning(s); re-run with -feature for details
[WARNING] one warning found
[INFO] prepare-compile in 0 s
[INFO] compile in 6 s
[INFO]
[INFO] --- maven-compiler-plugin:3.3:compile (default-compile) @ adam-apis_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-test-source (add-test-source) @ adam-apis_2.10 ---
[INFO] Test Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/test/scala added.
[INFO]
[INFO] --- maven-resources-plugin:2.7:testResources (default-testResources) @ adam-apis_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] skip non existing resourceDirectory /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/test/resources
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:testCompile (scala-test-compile-first) @ adam-apis_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/test/java:-1: info: compiling
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/test/scala:-1: info: compiling
[INFO] Compiling 3 source files to /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/target/scala-2.10.4/test-classes at 1463194327622
[INFO] prepare-compile in 0 s
[INFO] compile in 7 s
[INFO]
[INFO] --- maven-compiler-plugin:3.3:testCompile (default-testCompile) @ adam-apis_2.10 ---
[INFO] Changes detected - recompiling the module!
[INFO] Compiling 2 source files to /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/target/scala-2.10.4/test-classes
[INFO]
[INFO] --- maven-surefire-plugin:2.18.1:test (default-test) @ adam-apis_2.10 ---
[INFO] Tests are skipped.
[INFO]
[INFO] --- scalatest-maven-plugin:1.0:test (test) @ adam-apis_2.10 ---
[INFO] Tests are skipped.
[INFO]
[INFO] --- maven-jar-plugin:2.6:jar (default-jar) @ adam-apis_2.10 ---
[INFO] Building jar: /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/target/adam-apis_2.10-0.19.0.jar
[INFO]
[INFO] --- maven-jar-plugin:2.6:test-jar (default) @ adam-apis_2.10 ---
[INFO] Building jar: /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/target/adam-apis_2.10-0.19.0-tests.jar
[INFO]
[INFO] ------------------------------------------------------------------------
[INFO] Building ADAM_2.10: CLI 0.19.0
[INFO] ------------------------------------------------------------------------
[INFO]
[INFO] --- maven-clean-plugin:2.6.1:clean (default-clean) @ adam-cli_2.10 ---
[INFO] Deleting /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-cli_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-cli_2.10 ---
[INFO]
[INFO] --- git-commit-id-plugin:2.2.0:revision (default) @ adam-cli_2.10 ---
[INFO]
[INFO] --- templating-maven-plugin:1.0-alpha-3:filter-sources (filter-src) @ adam-cli_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 1 resource
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/generated-sources/java-templates added.
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-source (add-source) @ adam-cli_2.10 ---
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/src/main/scala added.
[INFO]
[INFO] --- scalariform-maven-plugin:0.1.4:format (default-cli) @ adam-cli_2.10 ---
[INFO] Modified 0 of 36 .scala files
[INFO]
[INFO] --- maven-resources-plugin:2.7:resources (default-resources) @ adam-cli_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 1 resource
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:compile (scala-compile-first) @ adam-cli_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/generated-sources/java-templates:-1: info: compiling
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/src/main/scala:-1: info: compiling
[INFO] Compiling 26 source files to /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/scala-2.10.4/classes at 1463194338099
[INFO] prepare-compile in 0 s
[INFO] compile in 23 s
[INFO]
[INFO] --- maven-compiler-plugin:3.3:compile (default-compile) @ adam-cli_2.10 ---
[INFO] Changes detected - recompiling the module!
[INFO] Compiling 1 source file to /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/scala-2.10.4/classes
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-test-source (add-test-source) @ adam-cli_2.10 ---
[INFO] Test Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/src/test/scala added.
[INFO]
[INFO] --- maven-resources-plugin:2.7:testResources (default-testResources) @ adam-cli_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 9 resources
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:testCompile (scala-test-compile-first) @ adam-cli_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/src/test/scala:-1: info: compiling
[INFO] Compiling 11 source files to /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/scala-2.10.4/test-classes at 1463194361602
[INFO] prepare-compile in 0 s
[INFO] compile in 21 s
[INFO]
[INFO] --- maven-compiler-plugin:3.3:testCompile (default-testCompile) @ adam-cli_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-surefire-plugin:2.18.1:test (default-test) @ adam-cli_2.10 ---
[INFO] Tests are skipped.
[INFO]
[INFO] --- scalatest-maven-plugin:1.0:test (test) @ adam-cli_2.10 ---
[INFO] Tests are skipped.
[INFO]
[INFO] --- maven-jar-plugin:2.6:jar (default-jar) @ adam-cli_2.10 ---
[INFO] Building jar: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/adam-cli_2.10-0.19.0.jar
[INFO]
[INFO] --- maven-shade-plugin:2.4.1:shade (default) @ adam-cli_2.10 ---
[INFO] Including commons-cli:commons-cli:jar:1.2 in the shaded jar.
[INFO] Including commons-httpclient:commons-httpclient:jar:3.1 in the shaded jar.
[INFO] Including commons-codec:commons-codec:jar:1.4 in the shaded jar.
[INFO] Including commons-logging:commons-logging:jar:1.1.3 in the shaded jar.
[INFO] Including org.apache.commons:commons-compress:jar:1.4.1 in the shaded jar.
[INFO] Including org.codehaus.jackson:jackson-core-asl:jar:1.9.13 in the shaded jar.
[INFO] Including org.codehaus.jackson:jackson-mapper-asl:jar:1.9.13 in the shaded jar.
[INFO] Including com.google.code.findbugs:jsr305:jar:1.3.9 in the shaded jar.
[INFO] Including org.slf4j:slf4j-api:jar:1.7.10 in the shaded jar.
[INFO] Including log4j:log4j:jar:1.2.17 in the shaded jar.
[INFO] Including org.xerial.snappy:snappy-java:jar:1.1.1.7 in the shaded jar.
[INFO] Including com.thoughtworks.paranamer:paranamer:jar:2.6 in the shaded jar.
[INFO] Including org.bdgenomics.utils:utils-io_2.10:jar:0.2.4 in the shaded jar.
[INFO] Including org.bdgenomics.utils:utils-misc_2.10:jar:0.2.4 in the shaded jar.
[INFO] Including org.apache.httpcomponents:httpclient:jar:4.5.1 in the shaded jar.
[INFO] Including org.apache.httpcomponents:httpcore:jar:4.4.3 in the shaded jar.
[INFO] Including org.bdgenomics.utils:utils-cli_2.10:jar:0.2.4 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-avro:jar:1.8.1 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-column:jar:1.8.1 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-common:jar:1.8.1 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-encoding:jar:1.8.1 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-hadoop:jar:1.8.1 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-jackson:jar:1.8.1 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-format:jar:2.3.0-incubating in the shaded jar.
[INFO] Including org.bdgenomics.utils:utils-metrics_2.10:jar:0.2.4 in the shaded jar.
[INFO] Including com.netflix.servo:servo-core:jar:0.10.0 in the shaded jar.
[INFO] Including com.google.code.findbugs:annotations:jar:2.0.0 in the shaded jar.
[INFO] Including com.netflix.servo:servo-internal:jar:0.10.0 in the shaded jar.
[INFO] Including org.scoverage:scalac-scoverage-plugin_2.10:jar:1.1.1 in the shaded jar.
[INFO] Including org.bdgenomics.bdg-formats:bdg-formats:jar:0.7.0 in the shaded jar.
[INFO] Including org.apache.avro:avro:jar:1.7.7 in the shaded jar.
[INFO] Including org.bdgenomics.adam:adam-core_2.10:jar:0.19.0 in the shaded jar.
[INFO] Including com.esotericsoftware.kryo:kryo:jar:2.24.0 in the shaded jar.
[INFO] Including com.esotericsoftware.minlog:minlog:jar:1.2 in the shaded jar.
[INFO] Including org.objenesis:objenesis:jar:2.1 in the shaded jar.
[INFO] Including commons-io:commons-io:jar:1.3.2 in the shaded jar.
[INFO] Including it.unimi.dsi:fastutil:jar:6.6.5 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-scala_2.10:jar:1.8.1 in the shaded jar.
[INFO] Including org.seqdoop:hadoop-bam:jar:7.1.0 in the shaded jar.
[INFO] Including com.github.samtools:htsjdk:jar:1.139 in the shaded jar.
[INFO] Including org.apache.commons:commons-jexl:jar:2.1.1 in the shaded jar.
[INFO] Including org.tukaani:xz:jar:1.5 in the shaded jar.
[INFO] Including org.apache.ant:ant:jar:1.8.2 in the shaded jar.
[INFO] Including org.apache.ant:ant-launcher:jar:1.8.2 in the shaded jar.
[INFO] Including com.google.guava:guava:jar:16.0.1 in the shaded jar.
[INFO] Including org.bdgenomics.adam:adam-apis_2.10:jar:0.19.0 in the shaded jar.
[INFO] Including org.scala-lang:scala-library:jar:2.10.4 in the shaded jar.
[INFO] Including org.slf4j:slf4j-log4j12:jar:1.7.12 in the shaded jar.
[INFO] Including args4j:args4j:jar:2.0.31 in the shaded jar.
[INFO] Including net.codingwell:scala-guice_2.10:jar:4.0.0 in the shaded jar.
[INFO] Including com.google.inject:guice:jar:4.0 in the shaded jar.
[INFO] Including javax.inject:javax.inject:jar:1 in the shaded jar.
[INFO] Including aopalliance:aopalliance:jar:1.0 in the shaded jar.
[INFO] Including com.google.inject.extensions:guice-multibindings:jar:4.0 in the shaded jar.
[WARNING] annotations-2.0.0.jar, jsr305-1.3.9.jar define 34 overlapping classes:
[WARNING] - javax.annotation.Nonnegative
[WARNING] - javax.annotation.CheckForSigned
[WARNING] - javax.annotation.CheckForNull
[WARNING] - javax.annotation.Tainted
[WARNING] - javax.annotation.meta.TypeQualifierValidator
[WARNING] - javax.annotation.meta.TypeQualifier
[WARNING] - javax.annotation.Syntax
[WARNING] - javax.annotation.Detainted
[WARNING] - javax.annotation.Nonnull$Checker
[WARNING] - javax.annotation.meta.TypeQualifierNickname
[WARNING] - 24 more...
[WARNING] maven-shade-plugin has detected that some class files are
[WARNING] present in two or more JARs. When this happens, only one
[WARNING] single version of the class is copied to the uber jar.
[WARNING] Usually this is not harmful and you can skip these warnings,
[WARNING] otherwise try to manually exclude artifacts based on
[WARNING] mvn dependency:tree -Ddetail=true and the above output.
[WARNING] See http://docs.codehaus.org/display/MAVENUSER/Shade+Plugin
[INFO] Replacing original artifact with shaded artifact.
[INFO] Replacing /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/adam-cli_2.10-0.19.0.jar with /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/adam-cli_2.10-0.19.0-shaded.jar
[INFO] ------------------------------------------------------------------------
[INFO] Reactor Summary:
[INFO]
[INFO] ADAM_2.10 .......................................... SUCCESS [ 11.263 s]
[INFO] ADAM_2.10: Core .................................... SUCCESS [02:14 min]
[INFO] ADAM_2.10: APIs for Java ........................... SUCCESS [ 14.594 s]
[INFO] ADAM_2.10: CLI ..................................... SUCCESS [ 55.031 s]
[INFO] ------------------------------------------------------------------------
[INFO] BUILD SUCCESS
[INFO] ------------------------------------------------------------------------
[INFO] Total time: 03:35 min
[INFO] Finished at: 2016-05-14T10:53:10+08:00
[INFO] Final Memory: 77M/395M
[INFO] ------------------------------------------------------------------------
xubo@xubo:~/cloud/adam-2.10-0.19-git$
2.Ubuntu下对adam进行mvn test
[INFO] Scanning for projects...
[INFO] ------------------------------------------------------------------------
[INFO] Reactor Build Order:
[INFO]
[INFO] ADAM_2.10
[INFO] ADAM_2.10: Core
[INFO] ADAM_2.10: APIs for Java
[INFO] ADAM_2.10: CLI
[INFO]
[INFO] ------------------------------------------------------------------------
[INFO] Building ADAM_2.10 0.19.0
[INFO] ------------------------------------------------------------------------
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-parent_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-parent_2.10 ---
[INFO]
[INFO] --- scalariform-maven-plugin:0.1.4:format (default-cli) @ adam-parent_2.10 ---
[INFO] Modified 0 of 199 .scala files
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:compile (scala-compile-first) @ adam-parent_2.10 ---
[INFO] No sources to compile
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:testCompile (scala-test-compile-first) @ adam-parent_2.10 ---
[INFO] No sources to compile
[INFO]
[INFO] ------------------------------------------------------------------------
[INFO] Building ADAM_2.10: Core 0.19.0
[INFO] ------------------------------------------------------------------------
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-core_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-core_2.10 ---
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-source (add-source) @ adam-core_2.10 ---
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/main/scala added.
[INFO]
[INFO] --- scalariform-maven-plugin:0.1.4:format (default-cli) @ adam-core_2.10 ---
[INFO] Modified 0 of 159 .scala files
[INFO]
[INFO] --- maven-resources-plugin:2.7:resources (default-resources) @ adam-core_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 1 resource
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:compile (scala-compile-first) @ adam-core_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-metrics_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-io_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-cli_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.scoverage:scalac-scoverage-plugin_2.10:1.1.1 requires scala version: 2.10.4
[WARNING] org.bdgenomics.adam:adam-core_2.10:0.19.0 requires scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-compiler-plugin:3.3:compile (default-compile) @ adam-core_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-test-source (add-test-source) @ adam-core_2.10 ---
[INFO] Test Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/test/scala added.
[INFO]
[INFO] --- maven-resources-plugin:2.7:testResources (default-testResources) @ adam-core_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 65 resources
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:testCompile (scala-test-compile-first) @ adam-core_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-metrics_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-io_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-cli_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.scoverage:scalac-scoverage-plugin_2.10:1.1.1 requires scala version: 2.10.4
[WARNING] org.bdgenomics.adam:adam-core_2.10:0.19.0 requires scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-compiler-plugin:3.3:testCompile (default-testCompile) @ adam-core_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-surefire-plugin:2.18.1:test (default-test) @ adam-core_2.10 ---
[INFO] Tests are skipped.
[INFO]
[INFO] --- scalatest-maven-plugin:1.0:test (test) @ adam-core_2.10 ---
[36mDiscovery starting.[0m
[36mDiscovery completed in 1 second, 545 milliseconds.[0m
[36mRun starting. Expected test count is: 373[0m
[32mRichGenotypeSuite:[0m
[32m- different ploidy[0m
[32m- all types for diploid genotype[0m
[32mReferenceUtilsSuite:[0m
[32m- unionReferenceSet: empty[0m
[32m- unionReferenceSet: one region[0m
[32m- unionReferenceSet: multiple regions on one contig, all overlap[0m
[32m- unionReferenceSet: multiple regions on one contig, some overlap[0m
[32m- unionReferenceSet: multiple regions on multiple contigs[0m
[32mMdTagSuite:[0m
[32m- null md tag[0m
[32m- zero length md tag[0m
[32m- md tag with non-digit initial value[0m
[32m- md tag invalid base[0m
[32m- md tag, pure insertion[0m
[32m- md tag, pure insertion, test 2[0m
[32m- md tag pure insertion equality[0m
[32m- md tag equality and hashcode[0m
[32m- valid md tags[0m
[32m- get start of read with no mismatches or deletions[0m
[32m- get start of read with no mismatches, but with a deletion at the start[0m
[32m- get start of read with mismatches at the start[0m
[32m- get end of read with no mismatches or deletions[0m
[32m- check that mdtag and rich record return same end[0m
[32m- get end of read with no mismatches, but a deletion at end[0m
[32m- CIGAR with N operator[0m
[32m- CIGAR with multiple N operators[0m
[32m- CIGAR with P operators[0m
[32m- Get correct matches for mdtag with insertion[0m
[32m- Get correct matches for mdtag with mismatches and insertion[0m
[32m- Get correct matches for mdtag with insertion between mismatches[0m
[32m- Get correct matches for mdtag with intron between mismatches[0m
[32m- Get correct matches for mdtag with intron and deletion between mismatches[0m
[32m- Throw exception when number of deleted bases in mdtag disagrees with CIGAR[0m
[32m- Get correct matches for mdtag with mismatch, insertion and deletion[0m
[32m- Get correct matches for mdtag with mismatches, insertion and deletion[0m
[32m- Get correct matches for MDTag with mismatches and deletions[0m
[32m- Get correct matches base from MDTag and CIGAR with N[0m
[32m- get end of read with mismatches and a deletion at end[0m
[32m- get correct string out of mdtag with no mismatches[0m
[32m- get correct string out of mdtag with mismatches at start[0m
[32m- get correct string out of mdtag with deletion at end[0m
[32m- get correct string out of mdtag with mismatches at end[0m
[32m- get correct string out of complex mdtag[0m
[32m- check complex mdtag[0m
[32m- move a cigar alignment by two for a read[0m
[32m- rewrite alignment to all matches[0m
[32m- rewrite alignment to two mismatches followed by all matches[0m
[32m- rewrite alignment to include a deletion but otherwise all matches[0m
[32m- rewrite alignment to include an insertion at the start of the read but otherwise all matches[0m
[32m- create new md tag from read vs. reference, perfect match[0m
[32m- create new md tag from read vs. reference, perfect alignment match, 1 mismatch[0m
[32m- create new md tag from read vs. reference, alignment with deletion[0m
[32m- create new md tag from read vs. reference, alignment with insert[0m
[32m- handle '=' and 'X' operators[0m
[32m- CIGAR/MD tag mismatch should cause errors[0m
[32mGenotypesToVariantsConverterSuite:[0m
[32m- Simple test of integer RMS[0m
[32m- Simple test of floating point RMS[0m
[32m- Max genotype quality should lead to max variant quality[0m
[32m- Genotype quality = 0.5 for two samples should lead to variant quality of 0.75[0m
[32mPairingRDDSuite:[0m
2016-05-14 11:07:09 WARN NativeCodeLoader:62 - Unable to load native-hadoop library for your platform... using builtin-java classes where applicable
2016-05-14 11:07:11 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sliding on an empty RDD returns an empty RDD[0m
2016-05-14 11:07:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sliding on an RDD where count() < width returns an empty RDD[0m
2016-05-14 11:07:15 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sliding on an RDD where count() == width returns an RDD with one element.[0m
2016-05-14 11:07:16 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sliding on a small RDD works correctly[0m
2016-05-14 11:07:17 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sliding works correctly on a partitioned RDD[0m
2016-05-14 11:07:20 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- pairing a simple sequence works[0m
2016-05-14 11:07:20 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- pairing an empty sequence returns an empty sequence[0m
2016-05-14 11:07:21 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- pairing a sorted sequence works[0m
2016-05-14 11:07:22 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- pairWithEnds on an empty sequence returns an empty sequence[0m
2016-05-14 11:07:22 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- pairWithEnds gives us the right number and set of values[0m
[32mADAMVariationRDDFunctionsSuite:[0m
2016-05-14 11:07:23 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- recover samples from variant context[0m
2016-05-14 11:07:24 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- joins SNV database annotation[0m
2016-05-14 11:07:24 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can write, then read in .vcf file[0m
[32mSingleReadBucketSuite:[0m
[32m- convert unmapped pair to fragment[0m
[32m- convert proper pair to fragment[0m
[32m- convert read pair to fragment with first of pair chimeric read[0m
[32mFlankReferenceFragmentsSuite:[0m
[32m- don't put flanks on non-adjacent fragments[0m
[32m- put flanks on adjacent fragments[0m
[32mReferencePositionSuite:[0m
[32m- create reference position from mapped read[0m
[32m- create reference position from variant[0m
[32m- create reference position from genotype[0m
[32mAlignmentRecordRDDFunctionsSuite:[0m
2016-05-14 11:07:25 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sorting reads[0m
2016-05-14 11:07:27 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- characterizeTags counts integer tag values correctly[0m
2016-05-14 11:07:28 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- withTag returns only those records which have the appropriate tag[0m
2016-05-14 11:07:29 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- withTag, when given a tag name that doesn't exist in the input, returns an empty RDD[0m
2016-05-14 11:07:29 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- characterizeTagValues counts distinct values of a tag[0m
2016-05-14 11:07:29 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- characterizeTags counts tags in a SAM file correctly[0m
2016-05-14 11:07:29 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- round trip from ADAM to SAM and back to ADAM produces equivalent Read values[0m
2016-05-14 11:07:30 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- SAM conversion sets read mapped flag properly[0m
2016-05-14 11:07:31 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert malformed FASTQ (no quality scores) => SAM => well-formed FASTQ => SAM[0m
2016-05-14 11:07:31 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- round trip from ADAM to FASTQ and back to ADAM produces equivalent Read values[0m
2016-05-14 11:07:32 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- round trip from ADAM to paired-FASTQ and back to ADAM produces equivalent Read values[0m
2016-05-14 11:07:33 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:07:33 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:07:33 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- writing a small sorted file as SAM should produce the expected result[0m
2016-05-14 11:07:33 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:07:33 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:07:33 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- writing unordered sam from unordered sam[0m
2016-05-14 11:07:33 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:07:34 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:07:34 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- writing ordered sam from unordered sam[0m
2016-05-14 11:07:34 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:07:35 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:07:35 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- write single sam file back[0m
2016-05-14 11:07:36 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:07:36 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:07:36 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- write single bam file back[0m
[32mFlattenerSuite:[0m
[32m- Flatten schema and record[0m
[32mShuffleRegionJoinSuite:[0m
2016-05-14 11:07:37 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Overlapping reference regions[0m
2016-05-14 11:07:38 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Multiple reference regions do not throw exception[0m
2016-05-14 11:07:38 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- RegionJoin2 contains the same results as cartesianRegionJoin[0m
[32mConsensusGeneratorFromReadsSuite:[0m
2016-05-14 11:07:39 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- checking search for consensus list for artificial reads[0m
[32mNucleotideContigFragmentRDDFunctionsSuite:[0m
2016-05-14 11:07:39 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- generate sequence dict from fasta[0m
2016-05-14 11:07:39 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- recover reference string from a single contig fragment[0m
2016-05-14 11:07:40 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- recover trimmed reference string from a single contig fragment[0m
2016-05-14 11:07:40 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- recover reference string from multiple contig fragments[0m
2016-05-14 11:07:40 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- recover trimmed reference string from multiple contig fragments[0m
2016-05-14 11:07:41 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save single contig fragment as FASTA text file[0m
2016-05-14 11:07:41 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save single contig fragment with description as FASTA text file[0m
2016-05-14 11:07:41 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save single contig fragment with null fields as FASTA text file[0m
2016-05-14 11:07:42 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save single contig fragment with null fragment number as FASTA text file[0m
2016-05-14 11:07:42 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save single contig fragment with null number of fragments in contig as FASTA text file[0m
2016-05-14 11:07:42 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save multiple contig fragments from same contig as FASTA text file[0m
2016-05-14 11:07:42 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save multiple contig fragments with description from same contig as FASTA text file[0m
2016-05-14 11:07:43 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- merge single contig fragment null fragment number[0m
2016-05-14 11:07:43 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- merge single contig fragment number zero[0m
2016-05-14 11:07:43 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- merge multiple contig fragments[0m
[32mFragmentConverterSuite:[0m
[32m- build a fragment collector and convert to a read[0m
2016-05-14 11:07:44 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert an rdd of discontinuous fragments, all from the same contig[0m
2016-05-14 11:07:44 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert an rdd of contiguous fragments, all from the same contig[0m
2016-05-14 11:07:44 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert an rdd of varied fragments from multiple contigs[0m
[32mInterleavedFastqInputFormatSuite:[0m
2016-05-14 11:07:45 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- interleaved FASTQ hadoop reader: interleaved_fastq_sample1.ifq->interleaved_fastq_sample1.ifq.output[0m
2016-05-14 11:07:45 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- interleaved FASTQ hadoop reader: interleaved_fastq_sample2.ifq->interleaved_fastq_sample2.ifq.output[0m
2016-05-14 11:07:45 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- interleaved FASTQ hadoop reader: interleaved_fastq_sample3.ifq->interleaved_fastq_sample3.ifq.output[0m
2016-05-14 11:07:45 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- interleaved FASTQ hadoop reader: interleaved_fastq_sample4.ifq->interleaved_fastq_sample4.ifq.output[0m
[32mReferenceRegionSuite:[0m
[32m- contains(: ReferenceRegion)[0m
[32m- contains(: ReferencePosition)[0m
[32m- merge[0m
[32m- overlaps[0m
[32m- distance(: ReferenceRegion)[0m
[32m- distance(: ReferencePosition)[0m
[32m- create region from unmapped read fails[0m
[32m- create region from mapped read contains read start and end[0m
[32m- validate that adjacent regions can be merged[0m
[32m- validate that non-adjacent regions cannot be merged[0m
[32m- compute convex hull of two sets[0m
[32m- region name is sanitized when creating region from read[0m
[32m- intersection fails on non-overlapping regions[0m
[32m- compute intersection[0m
[32m- overlap tests for oriented reference region[0m
[32m- check the width of a reference region[0m
[32mAlignmentRecordConverterSuite:[0m
[32m- testing the fields in a converted ADAM Read[0m
[32m- converting a read with null quality is OK[0m
[32m- convert a read to fastq[0m
[32m- reverse complement reads when converting to fastq[0m
[32m- converting to fastq with unmapped reads[0m
[32m- converting a fragment with no alignments should yield unaligned reads[0m
[32m- converting a fragment with alignments should restore the alignments[0m
[32mIntervalListReaderSuite:[0m
[32m- Can read the simple GATK-supplied example interval list file[0m
[32mSingleFastqInputFormatSuite:[0m
2016-05-14 11:07:46 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- FASTQ hadoop reader: fastq_sample1.fq->single_fastq_sample1.fq.output[0m
2016-05-14 11:07:46 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- FASTQ hadoop reader: fastq_sample2.fq->single_fastq_sample2.fq.output[0m
2016-05-14 11:07:46 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- FASTQ hadoop reader: fastq_sample3.fq->single_fastq_sample3.fq.output[0m
2016-05-14 11:07:46 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- FASTQ hadoop reader: fastq_sample4.fq->single_fastq_sample4.fq.output[0m
[32mRegExpSuite:[0m
[32m- matches returns Some(matcher) when a complete match is found[0m
[32m- find returns Some(matcher) when a partial match is found[0m
[32mAttributeUtilsSuite:[0m
[32m- parseTags returns a reasonable set of tagStrings[0m
[32m- parseTags works with NumericSequence tagType[0m
[32m- empty string is parsed as zero tagStrings[0m
[32m- incorrectly formatted tag throws an exception[0m
[32m- string tag with a ':' in it is correctly parsed[0m
[32mMarkDuplicatesSuite:[0m
2016-05-14 11:07:46 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- single read[0m
2016-05-14 11:07:47 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- reads at different positions[0m
2016-05-14 11:07:47 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- reads at the same position[0m
2016-05-14 11:07:47 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- reads at the same position with clipping[0m
2016-05-14 11:07:48 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- reads on reverse strand[0m
2016-05-14 11:07:48 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- unmapped reads[0m
2016-05-14 11:07:48 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- read pairs[0m
2016-05-14 11:07:49 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- read pairs with fragments[0m
[32m- quality scores[0m
2016-05-14 11:07:49 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- read pairs that cross chromosomes[0m
[32mIndelRealignmentTargetSuite:[0m
2016-05-14 11:07:49 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- checking simple realignment target[0m
2016-05-14 11:07:49 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating simple target from read with deletion[0m
2016-05-14 11:07:49 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating simple target from read with insertion[0m
2016-05-14 11:07:50 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- joining simple realignment targets on same chr[0m
2016-05-14 11:07:50 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- joining simple realignment targets on different chr throws exception[0m
2016-05-14 11:07:50 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating targets from three intersecting reads, same indel[0m
2016-05-14 11:07:50 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating targets from three intersecting reads, two different indel[0m
2016-05-14 11:07:50 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating targets from two disjoint reads[0m
2016-05-14 11:07:51 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating targets for artificial reads: one-by-one[0m
2016-05-14 11:07:51 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating targets for artificial reads: all-at-once (merged)[0m
2016-05-14 11:07:51 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating indel targets for mason reads[0m
[32mTwoBitSuite:[0m
[32m- correctly read sequence from .2bit file[0m
[32m- correctly return masked sequences from .2bit file[0m
[32m- correctly return Ns from .2bit file[0m
[32mConsensusSuite:[0m
[32m- test the insertion of a consensus insertion into a reference[0m
[32m- test the insertion of a consensus deletion into a reference[0m
[32m- inserting empty consensus returns the reference[0m
[32mDecadentReadSuite:[0m
[32m- reference position of decadent read[0m
[32m- reference position of decadent read with insertions[0m
[32m- build a decadent read from a read with null qual[0m
[32m- converting bad read should fail[0m
2016-05-14 11:07:51 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:07:51 WARN DecadentRead:64 - Converting read {"readInFragment": 0, "contig": {"contigName": "1", "contigLength": null, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null, "referenceIndex": null}, "start": 248262648, "oldPosition": null, "end": 248262721, "mapq": 23, "readName": null, "sequence": "GATCTTTTCAACAGTTACAGCAGAAAGTTTTCATGGAGAAATGGAATCACACTTCAAATGATTTCATTTTGTTGGG", "qual": "IBBHEFFEKFCKFHFACKFIJFJDCFHFEEDJBCHIFIDDBCGJDBBJAJBJFCIDCACHBDEBHADDDADDAED;", "cigar": "4S1M1D71M", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": false, "properPair": false, "readMapped": true, "mateMapped": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": false, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": "3^C71", "origQual": null, "attributes": null, "recordGroupName": null, "recordGroupSample": null, "mateAlignmentStart": null, "mateAlignmentEnd": null, "mateContig": null, "inferredInsertSize": null} to decadent read failed with java.lang.IllegalArgumentException: Error "(D,Some(3)) (of class scala.Tuple2)" while constructing DecadentRead from Read({"readInFragment": 0, "contig": {"contigName": "1", "contigLength": null, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null, "referenceIndex": null}, "start": 248262648, "oldPosition": null, "end": 248262721, "mapq": 23, "readName": null, "sequence": "GATCTTTTCAACAGTTACAGCAGAAAGTTTTCATGGAGAAATGGAATCACACTTCAAATGATTTCATTTTGTTGGG", "qual": "IBBHEFFEKFCKFHFACKFIJFJDCFHFEEDJBCHIFIDDBCGJDBBJAJBJFCIDCACHBDEBHADDDADDAED;", "cigar": "4S1M1D71M", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": false, "properPair": false, "readMapped": true, "mateMapped": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": false, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": "3^C71", "origQual": null, "attributes": null, "recordGroupName": null, "recordGroupSample": null, "mateAlignmentStart": null, "mateAlignmentEnd": null, "mateContig": null, "inferredInsertSize": null}). Skipping...
[32m- convert an RDD that has an bad read in it with loose validation[0m
2016-05-14 11:07:52 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:07:52 ERROR Executor:96 - Exception in task 1.0 in stage 0.0 (TID 1)
java.lang.IllegalArgumentException: Error "(D,Some(3)) (of class scala.Tuple2)" while constructing DecadentRead from Read({"readInFragment": 0, "contig": {"contigName": "1", "contigLength": null, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null, "referenceIndex": null}, "start": 248262648, "oldPosition": null, "end": 248262721, "mapq": 23, "readName": null, "sequence": "GATCTTTTCAACAGTTACAGCAGAAAGTTTTCATGGAGAAATGGAATCACACTTCAAATGATTTCATTTTGTTGGG", "qual": "IBBHEFFEKFCKFHFACKFIJFJDCFHFEEDJBCHIFIDDBCGJDBBJAJBJFCIDCACHBDEBHADDDADDAED;", "cigar": "4S1M1D71M", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": false, "properPair": false, "readMapped": true, "mateMapped": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": false, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": "3^C71", "origQual": null, "attributes": null, "recordGroupName": null, "recordGroupSample": null, "mateAlignmentStart": null, "mateAlignmentEnd": null, "mateContig": null, "inferredInsertSize": null})
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:42)
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:34)
at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:57)
at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:55)
at scala.collection.Iterator$$anon$11.next(Iterator.scala:328)
at org.apache.spark.util.Utils$.getIteratorSize(Utils.scala:1555)
at org.apache.spark.rdd.RDD$$anonfun$count$1.apply(RDD.scala:1125)
at org.apache.spark.rdd.RDD$$anonfun$count$1.apply(RDD.scala:1125)
at org.apache.spark.SparkContext$$anonfun$runJob$5.apply(SparkContext.scala:1850)
at org.apache.spark.SparkContext$$anonfun$runJob$5.apply(SparkContext.scala:1850)
at org.apache.spark.scheduler.ResultTask.runTask(ResultTask.scala:66)
at org.apache.spark.scheduler.Task.run(Task.scala:88)
at org.apache.spark.executor.Executor$TaskRunner.run(Executor.scala:214)
at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1145)
at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615)
at java.lang.Thread.run(Thread.java:745)
Caused by: scala.MatchError: (D,Some(3)) (of class scala.Tuple2)
at org.bdgenomics.adam.util.MdTag$.apply(MdTag.scala:71)
at org.bdgenomics.adam.rich.RichAlignmentRecord.mdTag$lzycompute(RichAlignmentRecord.scala:98)
at org.bdgenomics.adam.rich.RichAlignmentRecord.mdTag(RichAlignmentRecord.scala:96)
at org.bdgenomics.adam.rich.RichAlignmentRecord.getReferenceBase$1(RichAlignmentRecord.scala:176)
at org.bdgenomics.adam.rich.RichAlignmentRecord.getReferenceContext(RichAlignmentRecord.scala:192)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1$$anonfun$2.apply(RichAlignmentRecord.scala:213)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1$$anonfun$2.apply(RichAlignmentRecord.scala:211)
at scala.collection.TraversableLike$$anonfun$map$1.apply(TraversableLike.scala:244)
at scala.collection.TraversableLike$$anonfun$map$1.apply(TraversableLike.scala:244)
at scala.collection.Iterator$class.foreach(Iterator.scala:727)
at scala.collection.AbstractIterator.foreach(Iterator.scala:1157)
at scala.collection.IterableLike$class.foreach(IterableLike.scala:72)
at scala.collection.AbstractIterable.foreach(Iterable.scala:54)
at scala.collection.TraversableLike$class.map(TraversableLike.scala:244)
at scala.collection.AbstractTraversable.map(Traversable.scala:105)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1.apply(RichAlignmentRecord.scala:211)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1.apply(RichAlignmentRecord.scala:200)
at scala.collection.LinearSeqOptimized$class.foldLeft(LinearSeqOptimized.scala:111)
at scala.collection.immutable.List.foldLeft(List.scala:84)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referenceContexts$lzycompute(RichAlignmentRecord.scala:200)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referenceContexts(RichAlignmentRecord.scala:198)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referencePositions$lzycompute(RichAlignmentRecord.scala:196)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referencePositions(RichAlignmentRecord.scala:196)
at org.bdgenomics.adam.rich.DecadentRead.<init>(DecadentRead.scala:91)
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:38)
... 15 more
2016-05-14 11:07:52 WARN TaskSetManager:71 - Lost task 1.0 in stage 0.0 (TID 1, localhost): java.lang.IllegalArgumentException: Error "(D,Some(3)) (of class scala.Tuple2)" while constructing DecadentRead from Read({"readInFragment": 0, "contig": {"contigName": "1", "contigLength": null, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null, "referenceIndex": null}, "start": 248262648, "oldPosition": null, "end": 248262721, "mapq": 23, "readName": null, "sequence": "GATCTTTTCAACAGTTACAGCAGAAAGTTTTCATGGAGAAATGGAATCACACTTCAAATGATTTCATTTTGTTGGG", "qual": "IBBHEFFEKFCKFHFACKFIJFJDCFHFEEDJBCHIFIDDBCGJDBBJAJBJFCIDCACHBDEBHADDDADDAED;", "cigar": "4S1M1D71M", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": false, "properPair": false, "readMapped": true, "mateMapped": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": false, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": "3^C71", "origQual": null, "attributes": null, "recordGroupName": null, "recordGroupSample": null, "mateAlignmentStart": null, "mateAlignmentEnd": null, "mateContig": null, "inferredInsertSize": null})
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:42)
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:34)
at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:57)
at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:55)
at scala.collection.Iterator$$anon$11.next(Iterator.scala:328)
at org.apache.spark.util.Utils$.getIteratorSize(Utils.scala:1555)
at org.apache.spark.rdd.RDD$$anonfun$count$1.apply(RDD.scala:1125)
at org.apache.spark.rdd.RDD$$anonfun$count$1.apply(RDD.scala:1125)
at org.apache.spark.SparkContext$$anonfun$runJob$5.apply(SparkContext.scala:1850)
at org.apache.spark.SparkContext$$anonfun$runJob$5.apply(SparkContext.scala:1850)
at org.apache.spark.scheduler.ResultTask.runTask(ResultTask.scala:66)
at org.apache.spark.scheduler.Task.run(Task.scala:88)
at org.apache.spark.executor.Executor$TaskRunner.run(Executor.scala:214)
at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1145)
at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615)
at java.lang.Thread.run(Thread.java:745)
Caused by: scala.MatchError: (D,Some(3)) (of class scala.Tuple2)
at org.bdgenomics.adam.util.MdTag$.apply(MdTag.scala:71)
at org.bdgenomics.adam.rich.RichAlignmentRecord.mdTag$lzycompute(RichAlignmentRecord.scala:98)
at org.bdgenomics.adam.rich.RichAlignmentRecord.mdTag(RichAlignmentRecord.scala:96)
at org.bdgenomics.adam.rich.RichAlignmentRecord.getReferenceBase$1(RichAlignmentRecord.scala:176)
at org.bdgenomics.adam.rich.RichAlignmentRecord.getReferenceContext(RichAlignmentRecord.scala:192)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1$$anonfun$2.apply(RichAlignmentRecord.scala:213)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1$$anonfun$2.apply(RichAlignmentRecord.scala:211)
at scala.collection.TraversableLike$$anonfun$map$1.apply(TraversableLike.scala:244)
at scala.collection.TraversableLike$$anonfun$map$1.apply(TraversableLike.scala:244)
at scala.collection.Iterator$class.foreach(Iterator.scala:727)
at scala.collection.AbstractIterator.foreach(Iterator.scala:1157)
at scala.collection.IterableLike$class.foreach(IterableLike.scala:72)
at scala.collection.AbstractIterable.foreach(Iterable.scala:54)
at scala.collection.TraversableLike$class.map(TraversableLike.scala:244)
at scala.collection.AbstractTraversable.map(Traversable.scala:105)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1.apply(RichAlignmentRecord.scala:211)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1.apply(RichAlignmentRecord.scala:200)
at scala.collection.LinearSeqOptimized$class.foldLeft(LinearSeqOptimized.scala:111)
at scala.collection.immutable.List.foldLeft(List.scala:84)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referenceContexts$lzycompute(RichAlignmentRecord.scala:200)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referenceContexts(RichAlignmentRecord.scala:198)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referencePositions$lzycompute(RichAlignmentRecord.scala:196)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referencePositions(RichAlignmentRecord.scala:196)
at org.bdgenomics.adam.rich.DecadentRead.<init>(DecadentRead.scala:91)
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:38)
... 15 more
2016-05-14 11:07:52 ERROR TaskSetManager:75 - Task 1 in stage 0.0 failed 1 times; aborting job
[32m- converting an RDD that has an bad read in it with strict validation will throw an error[0m
[32mAlphabetSuite:[0m
[32m- test size of a case-sensitive alphabet[0m
[32m- test apply of a case-sensitive alphabet[0m
[32m- test reverse complement of a case-sensitive alphabet[0m
[32m- test exact reverse complement of a case-sensitive alphabet[0m
[32m- test size of a case-insensitive alphabet[0m
[32m- test apply of a case-insensitive alphabet[0m
[32m- test reverse complement of a case-insensitive alphabet[0m
[32m- test exact reverse complement of a case-insensitive alphabet[0m
[32m- DNA alphabet[0m
[32m- map unknown bases to N[0m
[32mFieldEnumerationSuite:[0m
2016-05-14 11:07:52 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
SLF4J: Failed to load class "org.slf4j.impl.StaticLoggerBinder".
SLF4J: Defaulting to no-operation (NOP) logger implementation
SLF4J: See http://www.slf4j.org/codes.html#StaticLoggerBinder for further details.
[32m- Empty projections are illegal[0m
2016-05-14 11:07:52 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:07:53 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Simple projection on Read works[0m
[32mBroadcastRegionJoinSuite:[0m
[32m- alternating returns an alternating seq of items[0m
[32m- Single region returns itself[0m
[32m- Two adjacent regions will be merged[0m
[32m- Nonoverlapping regions will all be returned[0m
[32m- Many overlapping regions will all be merged[0m
[32m- ADAMRecords return proper references[0m
2016-05-14 11:07:53 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Ensure same reference regions get passed together[0m
2016-05-14 11:07:54 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Overlapping reference regions[0m
2016-05-14 11:07:54 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Multiple reference regions do not throw exception[0m
2016-05-14 11:07:55 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- regionJoin contains the same results as cartesianRegionJoin[0m
[32mCoverageSuite:[0m
[32m- regionToWindows[0m
[32m- calculate empty coverage[0m
[32m- calculate coverage of one region[0m
[32m- calculate coverage of two regions[0m
[32m- calculate coverage of three regions[0m
[32m- calculate coverage of two adjacent regions[0m
[32m- calculate coverage of two nearby regions[0m
[32m- calculate coverage of three out-of-order regions[0m
[32m- calculate coverage of two regions which join at a window boundary[0m
2016-05-14 11:07:56 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find empty coverage[0m
2016-05-14 11:07:57 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of one region[0m
2016-05-14 11:07:57 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of two regions[0m
2016-05-14 11:07:58 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of three regions[0m
2016-05-14 11:08:00 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of two adjacent regions[0m
2016-05-14 11:08:01 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of two nearby regions[0m
2016-05-14 11:08:02 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of three out-of-order regions[0m
2016-05-14 11:08:03 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of two regions which join at a window boundary[0m
[32mVariantContextConverterSuite:[0m
[32m- Convert GATK site-only SNV to ADAM[0m
[32m- Convert GATK site-only SNV to ADAM with contig conversion[0m
[32m- Convert GATK site-only CNV to ADAM[0m
[32m- Convert GATK SNV w/ genotypes w/ phase information to ADAM[0m
[32m- Convert GATK SNV with different filters to ADAM[0m
[32m- Convert ADAM site-only SNV to GATK[0m
[32m- Convert ADAM site-only SNV to GATK with contig conversion[0m
[32m- Convert ADAM SNV w/ genotypes to GATK[0m
[32m- Convert GATK multi-allelic sites-only SNVs to ADAM[0m
[32m- Convert GATK multi-allelic SNVs to ADAM[0m
[32m- Convert gVCF reference records to ADAM[0m
[32mAttributeSuite:[0m
[32m- test SAMTagAndValue parsing[0m
[32m- Attributes can be correctly re-encoded as text SAM tags[0m
[32mSAMRecordConverterSuite:[0m
[32m- testing the fields in an alignmentRecord obtained from a mapped samRecord conversion[0m
[32m- testing the fields in an alignmentRecord obtained from an unmapped samRecord conversion[0m
[32m- '*' quality gets nulled out[0m
[32mADAMContextSuite:[0m
2016-05-14 11:08:04 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sc.loadParquet should not fail on unmapped reads[0m
2016-05-14 11:08:05 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sc.loadParquet should not load a file without a type specified[0m
2016-05-14 11:08:05 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can read a small .SAM file[0m
2016-05-14 11:08:05 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can read a small .SAM with all attribute tag types[0m
2016-05-14 11:08:05 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can filter a .SAM file based on quality[0m
[32m- Can convert to phred[0m
[32m- Can convert from phred[0m
2016-05-14 11:08:05 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- findFiles correctly finds a nested set of directories[0m
2016-05-14 11:08:05 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- loadADAMFromPaths can load simple RDDs that have just been saved[0m
2016-05-14 11:08:06 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Can read a .gtf file[0m
2016-05-14 11:08:06 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Can read a .bed file[0m
2016-05-14 11:08:06 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Can read a .narrowPeak file[0m
2016-05-14 11:08:06 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Can read a .interval_list file[0m
2016-05-14 11:08:07 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can read a small .vcf file[0m
2016-05-14 11:08:08 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from interleaved FASTQ: 1[0m
2016-05-14 11:08:08 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from interleaved FASTQ: 2[0m
2016-05-14 11:08:08 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from interleaved FASTQ: 3[0m
2016-05-14 11:08:08 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from interleaved FASTQ: 4[0m
2016-05-14 11:08:09 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from single ended FASTQ: 1[0m
2016-05-14 11:08:09 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from single ended FASTQ: 2[0m
2016-05-14 11:08:09 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from single ended FASTQ: 3[0m
2016-05-14 11:08:10 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from single ended FASTQ: 4[0m
2016-05-14 11:08:10 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- filter on load using the filter2 API[0m
[32mRichCigarSuite:[0m
[32m- moving 2 bp from a deletion to a match operator[0m
[32m- moving 2 bp from a insertion to a match operator[0m
[32m- moving 1 base in a two element cigar[0m
[32m- move to start of read[0m
[32mUtilSuite:[0m
[32m- isSameConfig[0m
[32mMDTaggingSuite:[0m
2016-05-14 11:08:11 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test adding MDTags over boundary[0m
2016-05-14 11:08:11 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test adding MDTags; reads span full contig[0m
2016-05-14 11:08:11 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test adding MDTags; reads start inside first fragment[0m
2016-05-14 11:08:12 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test adding MDTags; reads end inside last fragment[0m
2016-05-14 11:08:12 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test adding MDTags; reads start inside first fragment and end inside last fragment[0m
2016-05-14 11:08:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test adding MDTags; reads start and end in middle fragements[0m
[32mNormalizationUtilsSuite:[0m
[32m- cannot move an indel left if there are no bases to it's left[0m
[32m- move a simple indel to farthest position left until bases run out[0m
[32m- move a simple indel to farthest position left, past length of indel[0m
[32m- cannot move a left normalized indel in a short tandem repeat[0m
[32m- move an indel in a short tandem repeat[0m
[32m- move an indel in a short tandem repeat of more than 2 bases, where shift is not an integer multiple of repeated sequence length[0m
[32m- moving a simple read with single deletion that cannot shift[0m
[32m- shift an indel left by 0 in a cigar[0m
[32m- shift an indel left by 1 in a cigar[0m
[32m- do not left align a complex read which is already left aligned[0m
[32mSmithWatermanSuite:[0m
[32m- gather max position from simple scoring matrix[0m
[32m- gather max position from irregular scoring matrix[0m
[32m- gather max position from irregular scoring matrix with deletions[0m
[32m- score simple alignment with constant gap[0m
[32m- score irregular scoring matrix[0m
[32m- score irregular scoring matrix with indel[0m
[32m- can unroll cigars correctly[0m
[32m- execute simple trackback[0m
[32m- execute trackback with indel[0m
[32m- run end to end smith waterman for simple reads[0m
[32m- run end to end smith waterman for short sequences with indel[0m
[32m- run end to end smith waterman for longer sequences with snp[0m
[32m- run end to end smith waterman for longer sequences with short indel[0m
[32m- run end to end smith waterman for shorter sequence in longer sequence[0m
[32m- run end to end smith waterman for shorter sequence in longer sequence, with indel[0m
[32mFastaConverterSuite:[0m
2016-05-14 11:08:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find contig index[0m
[32m- convert a single record without naming information[0m
[32m- convert a single record with naming information[0m
2016-05-14 11:08:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert single fasta sequence[0m
2016-05-14 11:08:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert fasta with multiple sequences[0m
2016-05-14 11:08:14 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert fasta with multiple sequences; short fragment[0m
2016-05-14 11:08:14 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert reference fasta file[0m
[32mIndelTableSuite:[0m
[32m- check for indels in a region with known indels[0m
[32m- check for indels in a contig that doesn't exist[0m
[32m- check for indels in a region without known indels[0m
2016-05-14 11:08:15 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- build indel table from rdd of variants[0m
[32mRealignIndelsSuite:[0m
2016-05-14 11:08:15 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- checking mapping to targets for artificial reads[0m
2016-05-14 11:08:15 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- checking alternative consensus for artificial reads[0m
2016-05-14 11:08:15 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- checking extraction of reference from reads[0m
2016-05-14 11:08:15 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- checking realigned reads for artificial input[0m
2016-05-14 11:08:16 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test mismatch quality scoring[0m
2016-05-14 11:08:16 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test mismatch quality scoring for no mismatches[0m
2016-05-14 11:08:16 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test mismatch quality scoring after unpacking read[0m
[32m- we shouldn't try to realign a region with no target[0m
2016-05-14 11:08:16 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- we shouldn't try to realign reads with no indel evidence[0m
2016-05-14 11:08:16 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test OP and OC tags[0m
[32mBaseQualityRecalibrationSuite:[0m
2016-05-14 11:08:17 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- BQSR Test Input #1[0m
2016-05-14 11:08:25 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- BQSR Test Input #1 w/ VCF Sites[0m
[32mProgramRecordSuite:[0m
[32m- convert a sam program record with no optional fields into a program record and v/v[0m
[32m- convert a sam program record into a program record and v/v[0m
[32mSequenceDictionarySuite:[0m
[32m- Convert from sam sequence record and back[0m
[32m- Convert from SAM sequence dictionary file (with extra fields)[0m
[32m- merge into existing dictionary[0m
[32m- Convert from SAM sequence dictionary and back[0m
[32m- Can retrieve sequence by name[0m
[32m- SequenceDictionary's with same single element are equal[0m
[32m- SequenceDictionary's with same two elements are equals[0m
[32m- SequenceDictionary's with different elements are unequal[0m
[32m- SequenceDictionaries with same elements in different order are compatible[0m
[32m- isCompatible tests equality on overlap[0m
[32m- The addition + works correctly[0m
[32m- The append operation ++ works correctly[0m
[32m- ContainsRefName works correctly for different string types[0m
[32m- Apply on name works correctly for different String types[0m
[32m- convert from sam sequence record and back[0m
[32m- convert from sam sequence dictionary and back[0m
[32m- conversion to sam sequence dictionary has correct sort order[0m
[32mGenomicPositionPartitionerSuite:[0m
[32m- partitions the UNMAPPED ReferencePosition into the top partition[0m
[32m- if we do not have a contig for a record, we throw an IAE[0m
[32m- partitioning into N pieces on M total sequence length, where N > M, results in M partitions[0m
[32m- correctly partitions a single dummy sequence into two pieces[0m
[32m- correctly counts cumulative lengths[0m
[32m- correctly partitions positions across two dummy sequences[0m
2016-05-14 11:08:30 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:08:30 WARN TaskSetManager:71 - Stage 0 contains a task of very large size (131 KB). The maximum recommended task size is 100 KB.
2016-05-14 11:08:30 WARN TaskSetManager:71 - Stage 1 contains a task of very large size (131 KB). The maximum recommended task size is 100 KB.
[32m- test that we can range partition ADAMRecords[0m
2016-05-14 11:08:31 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test that simple partitioning works okay on a reasonable set of ADAMRecords[0m
[32mRichAlignmentRecordSuite:[0m
[32m- referenceLengthFromCigar[0m
[32m- Unclipped Start[0m
[32m- Unclipped End[0m
[32m- Illumina Optics[0m
[32m- Cigar Clipping Sequence[0m
[32m- tags contains optional fields[0m
[32m- Reference Positions[0m
[32m- read overlap unmapped read[0m
[32m- read overlap reference position[0m
[32m- read overlap same position different contig[0m
[32mGeneSuite:[0m
2016-05-14 11:08:32 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can load a set of gene models from an Ensembl GTF file[0m
2016-05-14 11:08:32 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can load a set of gene models from a Gencode GTF file[0m
2016-05-14 11:08:33 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- chr20 gencode transcript sequences match the published sequences[0m
[32mMapToolsSuite:[0m
[32m- add two nonzero integer maps[0m
[32m- add two nonzero float maps[0m
[32m- adding an empty map is the identity[0m
[32mRecordGroupDictionarySuite:[0m
[32m- simple conversion to and from sam read group[0m
[32m- sample name must be set[0m
[32m- simple equality checks[0m
[36mRun completed in 1 minute, 26 seconds.[0m
[36mTotal number of tests run: 373[0m
[36mSuites: completed 52, aborted 0[0m
[36mTests: succeeded 373, failed 0, canceled 0, ignored 0, pending 0[0m
[32mAll tests passed.[0m
May 14, 2016 11:08:11 AM INFO: org.apache.parquet.filter2.compat.FilterCompat: Filtering using predicate: eq(start, 16097631)
May 14, 2016 11:08:11 AM INFO: org.apache.parquet.filter2.compat.FilterCompat: Filtering using predicate: eq(start, 16097631)
[INFO]
[INFO] ------------------------------------------------------------------------
[INFO] Building ADAM_2.10: APIs for Java 0.19.0
[INFO] ------------------------------------------------------------------------
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-apis_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-apis_2.10 ---
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-source (add-source) @ adam-apis_2.10 ---
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/main/scala added.
[INFO]
[INFO] --- scalariform-maven-plugin:0.1.4:format (default-cli) @ adam-apis_2.10 ---
[INFO] Modified 0 of 4 .scala files
[INFO]
[INFO] --- maven-resources-plugin:2.7:resources (default-resources) @ adam-apis_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] skip non existing resourceDirectory /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/main/resources
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:compile (scala-compile-first) @ adam-apis_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-compiler-plugin:3.3:compile (default-compile) @ adam-apis_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-test-source (add-test-source) @ adam-apis_2.10 ---
[INFO] Test Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/test/scala added.
[INFO]
[INFO] --- maven-resources-plugin:2.7:testResources (default-testResources) @ adam-apis_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] skip non existing resourceDirectory /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/test/resources
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:testCompile (scala-test-compile-first) @ adam-apis_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-compiler-plugin:3.3:testCompile (default-testCompile) @ adam-apis_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-surefire-plugin:2.18.1:test (default-test) @ adam-apis_2.10 ---
[INFO] Tests are skipped.
[INFO]
[INFO] --- scalatest-maven-plugin:1.0:test (test) @ adam-apis_2.10 ---
[36mDiscovery starting.[0m
[36mDiscovery completed in 465 milliseconds.[0m
[36mRun starting. Expected test count is: 2[0m
[32mJavaADAMContextSuite:[0m
2016-05-14 11:08:37 WARN NativeCodeLoader:62 - Unable to load native-hadoop library for your platform... using builtin-java classes where applicable
2016-05-14 11:08:40 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can read a small .SAM file[0m
2016-05-14 11:08:42 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
SLF4J: Failed to load class "org.slf4j.impl.StaticLoggerBinder".
SLF4J: Defaulting to no-operation (NOP) logger implementation
SLF4J: See http://www.slf4j.org/codes.html#StaticLoggerBinder for further details.
[32m- can read a small .SAM file inside of java[0m
[36mRun completed in 7 seconds, 879 milliseconds.[0m
[36mTotal number of tests run: 2[0m
[36mSuites: completed 2, aborted 0[0m
[36mTests: succeeded 2, failed 0, canceled 0, ignored 0, pending 0[0m
[32mAll tests passed.[0m
[INFO]
[INFO] ------------------------------------------------------------------------
[INFO] Building ADAM_2.10: CLI 0.19.0
[INFO] ------------------------------------------------------------------------
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-cli_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-cli_2.10 ---
[INFO]
[INFO] --- git-commit-id-plugin:2.2.0:revision (default) @ adam-cli_2.10 ---
[INFO]
[INFO] --- templating-maven-plugin:1.0-alpha-3:filter-sources (filter-src) @ adam-cli_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 1 resource
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/generated-sources/java-templates added.
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-source (add-source) @ adam-cli_2.10 ---
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/src/main/scala added.
[INFO]
[INFO] --- scalariform-maven-plugin:0.1.4:format (default-cli) @ adam-cli_2.10 ---
[INFO] Modified 0 of 36 .scala files
[INFO]
[INFO] --- maven-resources-plugin:2.7:resources (default-resources) @ adam-cli_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 1 resource
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:compile (scala-compile-first) @ adam-cli_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/generated-sources/java-templates:-1: info: compiling
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/src/main/scala:-1: info: compiling
[INFO] Compiling 26 source files to /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/scala-2.10.4/classes at 1463195327139
[INFO] prepare-compile in 0 s
[INFO] compile in 22 s
[INFO]
[INFO] --- maven-compiler-plugin:3.3:compile (default-compile) @ adam-cli_2.10 ---
[INFO] Changes detected - recompiling the module!
[INFO] Compiling 1 source file to /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/scala-2.10.4/classes
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-test-source (add-test-source) @ adam-cli_2.10 ---
[INFO] Test Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/src/test/scala added.
[INFO]
[INFO] --- maven-resources-plugin:2.7:testResources (default-testResources) @ adam-cli_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 9 resources
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:testCompile (scala-test-compile-first) @ adam-cli_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-compiler-plugin:3.3:testCompile (default-testCompile) @ adam-cli_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-surefire-plugin:2.18.1:test (default-test) @ adam-cli_2.10 ---
[INFO] Tests are skipped.
[INFO]
[INFO] --- scalatest-maven-plugin:1.0:test (test) @ adam-cli_2.10 ---
[36mDiscovery starting.[0m
[36mDiscovery completed in 392 milliseconds.[0m
[36mRun starting. Expected test count is: 33[0m
[32mTransformSuite:[0m
2016-05-14 11:09:12 WARN NativeCodeLoader:62 - Unable to load native-hadoop library for your platform... using builtin-java classes where applicable
2016-05-14 11:09:14 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:17 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:09:17 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- unordered sam to unordered sam[0m
2016-05-14 11:09:17 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:18 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:09:18 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- unordered sam to ordered sam[0m
2016-05-14 11:09:18 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
SLF4J: Failed to load class "org.slf4j.impl.StaticLoggerBinder".
SLF4J: Defaulting to no-operation (NOP) logger implementation
SLF4J: See http://www.slf4j.org/codes.html#StaticLoggerBinder for further details.
2016-05-14 11:09:20 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:09:20 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- unordered sam, to adam, to sam[0m
2016-05-14 11:09:20 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:21 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:09:21 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- unordered sam, to adam, to ordered sam[0m
[32mFlattenSuite:[0m
2016-05-14 11:09:21 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can flatten a simple VCF file[0m
[32mFlagStatSuite:[0m
2016-05-14 11:09:23 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Standard FlagStat test[0m
[32mViewSuite:[0m
2016-05-14 11:09:23 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:24 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -f 0 -F 0 is a no-op[0m
2016-05-14 11:09:25 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:25 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- no -f or -F args is a no-op[0m
2016-05-14 11:09:26 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:26 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -f 4: only unmapped reads[0m
2016-05-14 11:09:26 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:27 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -F 4: only mapped reads[0m
2016-05-14 11:09:27 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:27 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -f 4 -F 8: unmapped reads with mapped mates[0m
2016-05-14 11:09:28 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:28 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -f 12: unmapped reads with unmapped mates[0m
2016-05-14 11:09:28 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:28 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -g 12: reads that are unmapped or whose mate is unmapped[0m
2016-05-14 11:09:29 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:29 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -F 12: mapped reads with mapped mates[0m
2016-05-14 11:09:30 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:30 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -g 36: unmapped reads or reads with mate on negative strand[0m
2016-05-14 11:09:30 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:30 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -F 36: unmapped reads or reads with mate on negative strand[0m
[32mPluginExecutorSuite:[0m
2016-05-14 11:09:31 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- take10 works correctly on example SAM[0m
2016-05-14 11:09:31 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- java take10 works correctly on example SAM[0m
2016-05-14 11:09:31 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- takeN works correctly on example SAM with arg of '3'[0m
[32mADAM2FastaSuite:[0m
2016-05-14 11:09:32 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- round trip FASTA to nucleotide contig fragments in ADAM format to FASTA[0m
[32mFeatures2ADAMSuite:[0m
[33m- can convert a simple BED file !!! IGNORED !!![0m
2016-05-14 11:09:33 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can convert a simple wigfix file[0m
[32mAboutSuite:[0m
[32m- template variables have been replaced[0m
[32m- templated values are not empty[0m
[32mADAMMainSuite:[0m
[32m- default command groups is not empty[0m
[32m- module provides default command groups[0m
[32m- inject default command groups when called via main[0m
[32m- command groups is empty when called via apply[0m
[32m- single command group[0m
[32m- add new command group to default command groups[0m
[32m- module restores default command groups when called via apply[0m
[32m- custom module with single command group[0m
[32m- custom module with new command group added to default command groups[0m
[32mAdam2FastqSuite:[0m
2016-05-14 11:09:34 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:09:35 ERROR AlignmentRecordRDDFunctions:75 - Found 16 read names that don't occur exactly twice:
1x: 16
Samples:
SRR062634.16445865
SRR062634.9119161
SRR062634.17190076
SRR062634.17969132
SRR062634.7301099
SRR062634.2087100
SRR062634.20911784
SRR062634.16769670
SRR062634.18958430
SRR062634.12099057
SRR062634.12606172
SRR062634.14985224
SRR062634.10448889
SRR062634.4789722
SRR062634.3203184
SRR062634.17698657
[32m- convert SAM to paired FASTQ[0m
[36mRun completed in 24 seconds, 919 milliseconds.[0m
[36mTotal number of tests run: 33[0m
[36mSuites: completed 11, aborted 0[0m
[36mTests: succeeded 33, failed 0, canceled 0, ignored 1, pending 0[0m
[32mAll tests passed.[0m
[INFO] ------------------------------------------------------------------------
[INFO] Reactor Summary:
[INFO]
[INFO] ADAM_2.10 .......................................... SUCCESS [ 8.840 s]
[INFO] ADAM_2.10: Core .................................... SUCCESS [01:40 min]
[INFO] ADAM_2.10: APIs for Java ........................... SUCCESS [ 10.696 s]
[INFO] ADAM_2.10: CLI ..................................... SUCCESS [ 52.030 s]
[INFO] ------------------------------------------------------------------------
[INFO] BUILD SUCCESS
[INFO] ------------------------------------------------------------------------
[INFO] Total time: 02:52 min
[INFO] Finished at: 2016-05-14T11:09:36+08:00
[INFO] Final Memory: 48M/400M
[INFO] ------------------------------------------------------------------------
3.mvn install 记录 :
[INFO] Scanning for projects...
[INFO] ------------------------------------------------------------------------
[INFO] Reactor Build Order:
[INFO]
[INFO] ADAM_2.10
[INFO] ADAM_2.10: Core
[INFO] ADAM_2.10: APIs for Java
[INFO] ADAM_2.10: CLI
[INFO]
[INFO] ------------------------------------------------------------------------
[INFO] Building ADAM_2.10 0.19.0
[INFO] ------------------------------------------------------------------------
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-parent_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-parent_2.10 ---
[INFO]
[INFO] --- scalariform-maven-plugin:0.1.4:format (default-cli) @ adam-parent_2.10 ---
[INFO] Modified 0 of 199 .scala files
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:compile (scala-compile-first) @ adam-parent_2.10 ---
[INFO] No sources to compile
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:testCompile (scala-test-compile-first) @ adam-parent_2.10 ---
[INFO] No sources to compile
[INFO]
[INFO] >>> scala-maven-plugin:3.2.2:doc-jar (attach-scaladocs) > generate-sources @ adam-parent_2.10 >>>
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-parent_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-parent_2.10 ---
[INFO]
[INFO] <<< scala-maven-plugin:3.2.2:doc-jar (attach-scaladocs) < generate-sources @ adam-parent_2.10 <<<
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:doc-jar (attach-scaladocs) @ adam-parent_2.10 ---
[INFO] No source files found
[INFO]
[INFO] --- maven-install-plugin:2.5.2:install (default-install) @ adam-parent_2.10 ---
[INFO] Installing /home/xubo/cloud/adam-2.10-0.19-git/pom.xml to /home/xubo/.m2/repository/org/bdgenomics/adam/adam-parent_2.10/0.19.0/adam-parent_2.10-0.19.0.pom
[INFO]
[INFO] ------------------------------------------------------------------------
[INFO] Building ADAM_2.10: Core 0.19.0
[INFO] ------------------------------------------------------------------------
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-core_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-core_2.10 ---
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-source (add-source) @ adam-core_2.10 ---
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/main/scala added.
[INFO]
[INFO] --- scalariform-maven-plugin:0.1.4:format (default-cli) @ adam-core_2.10 ---
[INFO] Modified 0 of 159 .scala files
[INFO]
[INFO] --- maven-resources-plugin:2.7:resources (default-resources) @ adam-core_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 1 resource
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:compile (scala-compile-first) @ adam-core_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-metrics_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-io_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-cli_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.scoverage:scalac-scoverage-plugin_2.10:1.1.1 requires scala version: 2.10.4
[WARNING] org.bdgenomics.adam:adam-core_2.10:0.19.0 requires scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-compiler-plugin:3.3:compile (default-compile) @ adam-core_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-test-source (add-test-source) @ adam-core_2.10 ---
[INFO] Test Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/test/scala added.
[INFO]
[INFO] --- maven-resources-plugin:2.7:testResources (default-testResources) @ adam-core_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 65 resources
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:testCompile (scala-test-compile-first) @ adam-core_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-metrics_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-io_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-cli_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.scoverage:scalac-scoverage-plugin_2.10:1.1.1 requires scala version: 2.10.4
[WARNING] org.bdgenomics.adam:adam-core_2.10:0.19.0 requires scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-compiler-plugin:3.3:testCompile (default-testCompile) @ adam-core_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-surefire-plugin:2.18.1:test (default-test) @ adam-core_2.10 ---
[INFO] Tests are skipped.
[INFO]
[INFO] --- scalatest-maven-plugin:1.0:test (test) @ adam-core_2.10 ---
[36mDiscovery starting.[0m
[36mDiscovery completed in 1 second, 532 milliseconds.[0m
[36mRun starting. Expected test count is: 373[0m
[32mRichGenotypeSuite:[0m
[32m- different ploidy[0m
[32m- all types for diploid genotype[0m
[32mReferenceUtilsSuite:[0m
[32m- unionReferenceSet: empty[0m
[32m- unionReferenceSet: one region[0m
[32m- unionReferenceSet: multiple regions on one contig, all overlap[0m
[32m- unionReferenceSet: multiple regions on one contig, some overlap[0m
[32m- unionReferenceSet: multiple regions on multiple contigs[0m
[32mMdTagSuite:[0m
[32m- null md tag[0m
[32m- zero length md tag[0m
[32m- md tag with non-digit initial value[0m
[32m- md tag invalid base[0m
[32m- md tag, pure insertion[0m
[32m- md tag, pure insertion, test 2[0m
[32m- md tag pure insertion equality[0m
[32m- md tag equality and hashcode[0m
[32m- valid md tags[0m
[32m- get start of read with no mismatches or deletions[0m
[32m- get start of read with no mismatches, but with a deletion at the start[0m
[32m- get start of read with mismatches at the start[0m
[32m- get end of read with no mismatches or deletions[0m
[32m- check that mdtag and rich record return same end[0m
[32m- get end of read with no mismatches, but a deletion at end[0m
[32m- CIGAR with N operator[0m
[32m- CIGAR with multiple N operators[0m
[32m- CIGAR with P operators[0m
[32m- Get correct matches for mdtag with insertion[0m
[32m- Get correct matches for mdtag with mismatches and insertion[0m
[32m- Get correct matches for mdtag with insertion between mismatches[0m
[32m- Get correct matches for mdtag with intron between mismatches[0m
[32m- Get correct matches for mdtag with intron and deletion between mismatches[0m
[32m- Throw exception when number of deleted bases in mdtag disagrees with CIGAR[0m
[32m- Get correct matches for mdtag with mismatch, insertion and deletion[0m
[32m- Get correct matches for mdtag with mismatches, insertion and deletion[0m
[32m- Get correct matches for MDTag with mismatches and deletions[0m
[32m- Get correct matches base from MDTag and CIGAR with N[0m
[32m- get end of read with mismatches and a deletion at end[0m
[32m- get correct string out of mdtag with no mismatches[0m
[32m- get correct string out of mdtag with mismatches at start[0m
[32m- get correct string out of mdtag with deletion at end[0m
[32m- get correct string out of mdtag with mismatches at end[0m
[32m- get correct string out of complex mdtag[0m
[32m- check complex mdtag[0m
[32m- move a cigar alignment by two for a read[0m
[32m- rewrite alignment to all matches[0m
[32m- rewrite alignment to two mismatches followed by all matches[0m
[32m- rewrite alignment to include a deletion but otherwise all matches[0m
[32m- rewrite alignment to include an insertion at the start of the read but otherwise all matches[0m
[32m- create new md tag from read vs. reference, perfect match[0m
[32m- create new md tag from read vs. reference, perfect alignment match, 1 mismatch[0m
[32m- create new md tag from read vs. reference, alignment with deletion[0m
[32m- create new md tag from read vs. reference, alignment with insert[0m
[32m- handle '=' and 'X' operators[0m
[32m- CIGAR/MD tag mismatch should cause errors[0m
[32mGenotypesToVariantsConverterSuite:[0m
[32m- Simple test of integer RMS[0m
[32m- Simple test of floating point RMS[0m
[32m- Max genotype quality should lead to max variant quality[0m
[32m- Genotype quality = 0.5 for two samples should lead to variant quality of 0.75[0m
[32mPairingRDDSuite:[0m
2016-05-14 11:14:14 WARN NativeCodeLoader:62 - Unable to load native-hadoop library for your platform... using builtin-java classes where applicable
2016-05-14 11:14:16 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sliding on an empty RDD returns an empty RDD[0m
2016-05-14 11:14:18 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sliding on an RDD where count() < width returns an empty RDD[0m
2016-05-14 11:14:20 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sliding on an RDD where count() == width returns an RDD with one element.[0m
2016-05-14 11:14:21 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sliding on a small RDD works correctly[0m
2016-05-14 11:14:22 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sliding works correctly on a partitioned RDD[0m
2016-05-14 11:14:24 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- pairing a simple sequence works[0m
2016-05-14 11:14:25 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- pairing an empty sequence returns an empty sequence[0m
2016-05-14 11:14:26 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- pairing a sorted sequence works[0m
2016-05-14 11:14:26 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- pairWithEnds on an empty sequence returns an empty sequence[0m
2016-05-14 11:14:27 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- pairWithEnds gives us the right number and set of values[0m
[32mADAMVariationRDDFunctionsSuite:[0m
2016-05-14 11:14:28 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- recover samples from variant context[0m
2016-05-14 11:14:29 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- joins SNV database annotation[0m
2016-05-14 11:14:29 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can write, then read in .vcf file[0m
[32mSingleReadBucketSuite:[0m
[32m- convert unmapped pair to fragment[0m
[32m- convert proper pair to fragment[0m
[32m- convert read pair to fragment with first of pair chimeric read[0m
[32mFlankReferenceFragmentsSuite:[0m
[32m- don't put flanks on non-adjacent fragments[0m
[32m- put flanks on adjacent fragments[0m
[32mReferencePositionSuite:[0m
[32m- create reference position from mapped read[0m
[32m- create reference position from variant[0m
[32m- create reference position from genotype[0m
[32mAlignmentRecordRDDFunctionsSuite:[0m
2016-05-14 11:14:30 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sorting reads[0m
2016-05-14 11:14:32 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- characterizeTags counts integer tag values correctly[0m
2016-05-14 11:14:33 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- withTag returns only those records which have the appropriate tag[0m
2016-05-14 11:14:33 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- withTag, when given a tag name that doesn't exist in the input, returns an empty RDD[0m
2016-05-14 11:14:33 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- characterizeTagValues counts distinct values of a tag[0m
2016-05-14 11:14:34 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- characterizeTags counts tags in a SAM file correctly[0m
2016-05-14 11:14:34 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- round trip from ADAM to SAM and back to ADAM produces equivalent Read values[0m
2016-05-14 11:14:35 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- SAM conversion sets read mapped flag properly[0m
2016-05-14 11:14:35 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert malformed FASTQ (no quality scores) => SAM => well-formed FASTQ => SAM[0m
2016-05-14 11:14:36 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- round trip from ADAM to FASTQ and back to ADAM produces equivalent Read values[0m
2016-05-14 11:14:36 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- round trip from ADAM to paired-FASTQ and back to ADAM produces equivalent Read values[0m
2016-05-14 11:14:38 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:14:38 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:14:38 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- writing a small sorted file as SAM should produce the expected result[0m
2016-05-14 11:14:38 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:14:38 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:14:38 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- writing unordered sam from unordered sam[0m
2016-05-14 11:14:38 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:14:38 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:14:38 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- writing ordered sam from unordered sam[0m
2016-05-14 11:14:38 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:14:39 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:14:39 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- write single sam file back[0m
2016-05-14 11:14:40 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:14:41 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:14:41 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- write single bam file back[0m
[32mFlattenerSuite:[0m
[32m- Flatten schema and record[0m
[32mShuffleRegionJoinSuite:[0m
2016-05-14 11:14:42 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Overlapping reference regions[0m
2016-05-14 11:14:42 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Multiple reference regions do not throw exception[0m
2016-05-14 11:14:43 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- RegionJoin2 contains the same results as cartesianRegionJoin[0m
[32mConsensusGeneratorFromReadsSuite:[0m
2016-05-14 11:14:44 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- checking search for consensus list for artificial reads[0m
[32mNucleotideContigFragmentRDDFunctionsSuite:[0m
2016-05-14 11:14:44 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- generate sequence dict from fasta[0m
2016-05-14 11:14:44 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- recover reference string from a single contig fragment[0m
2016-05-14 11:14:44 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- recover trimmed reference string from a single contig fragment[0m
2016-05-14 11:14:44 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- recover reference string from multiple contig fragments[0m
2016-05-14 11:14:45 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- recover trimmed reference string from multiple contig fragments[0m
2016-05-14 11:14:45 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save single contig fragment as FASTA text file[0m
2016-05-14 11:14:46 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save single contig fragment with description as FASTA text file[0m
2016-05-14 11:14:46 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save single contig fragment with null fields as FASTA text file[0m
2016-05-14 11:14:46 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save single contig fragment with null fragment number as FASTA text file[0m
2016-05-14 11:14:46 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save single contig fragment with null number of fragments in contig as FASTA text file[0m
2016-05-14 11:14:47 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save multiple contig fragments from same contig as FASTA text file[0m
2016-05-14 11:14:47 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- save multiple contig fragments with description from same contig as FASTA text file[0m
2016-05-14 11:14:47 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- merge single contig fragment null fragment number[0m
2016-05-14 11:14:47 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- merge single contig fragment number zero[0m
2016-05-14 11:14:48 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- merge multiple contig fragments[0m
[32mFragmentConverterSuite:[0m
[32m- build a fragment collector and convert to a read[0m
2016-05-14 11:14:48 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert an rdd of discontinuous fragments, all from the same contig[0m
2016-05-14 11:14:49 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert an rdd of contiguous fragments, all from the same contig[0m
2016-05-14 11:14:49 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert an rdd of varied fragments from multiple contigs[0m
[32mInterleavedFastqInputFormatSuite:[0m
2016-05-14 11:14:49 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- interleaved FASTQ hadoop reader: interleaved_fastq_sample1.ifq->interleaved_fastq_sample1.ifq.output[0m
2016-05-14 11:14:50 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- interleaved FASTQ hadoop reader: interleaved_fastq_sample2.ifq->interleaved_fastq_sample2.ifq.output[0m
2016-05-14 11:14:50 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- interleaved FASTQ hadoop reader: interleaved_fastq_sample3.ifq->interleaved_fastq_sample3.ifq.output[0m
2016-05-14 11:14:50 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- interleaved FASTQ hadoop reader: interleaved_fastq_sample4.ifq->interleaved_fastq_sample4.ifq.output[0m
[32mReferenceRegionSuite:[0m
[32m- contains(: ReferenceRegion)[0m
[32m- contains(: ReferencePosition)[0m
[32m- merge[0m
[32m- overlaps[0m
[32m- distance(: ReferenceRegion)[0m
[32m- distance(: ReferencePosition)[0m
[32m- create region from unmapped read fails[0m
[32m- create region from mapped read contains read start and end[0m
[32m- validate that adjacent regions can be merged[0m
[32m- validate that non-adjacent regions cannot be merged[0m
[32m- compute convex hull of two sets[0m
[32m- region name is sanitized when creating region from read[0m
[32m- intersection fails on non-overlapping regions[0m
[32m- compute intersection[0m
[32m- overlap tests for oriented reference region[0m
[32m- check the width of a reference region[0m
[32mAlignmentRecordConverterSuite:[0m
[32m- testing the fields in a converted ADAM Read[0m
[32m- converting a read with null quality is OK[0m
[32m- convert a read to fastq[0m
[32m- reverse complement reads when converting to fastq[0m
[32m- converting to fastq with unmapped reads[0m
[32m- converting a fragment with no alignments should yield unaligned reads[0m
[32m- converting a fragment with alignments should restore the alignments[0m
[32mIntervalListReaderSuite:[0m
[32m- Can read the simple GATK-supplied example interval list file[0m
[32mSingleFastqInputFormatSuite:[0m
2016-05-14 11:14:50 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- FASTQ hadoop reader: fastq_sample1.fq->single_fastq_sample1.fq.output[0m
2016-05-14 11:14:50 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- FASTQ hadoop reader: fastq_sample2.fq->single_fastq_sample2.fq.output[0m
2016-05-14 11:14:50 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- FASTQ hadoop reader: fastq_sample3.fq->single_fastq_sample3.fq.output[0m
2016-05-14 11:14:51 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- FASTQ hadoop reader: fastq_sample4.fq->single_fastq_sample4.fq.output[0m
[32mRegExpSuite:[0m
[32m- matches returns Some(matcher) when a complete match is found[0m
[32m- find returns Some(matcher) when a partial match is found[0m
[32mAttributeUtilsSuite:[0m
[32m- parseTags returns a reasonable set of tagStrings[0m
[32m- parseTags works with NumericSequence tagType[0m
[32m- empty string is parsed as zero tagStrings[0m
[32m- incorrectly formatted tag throws an exception[0m
[32m- string tag with a ':' in it is correctly parsed[0m
[32mMarkDuplicatesSuite:[0m
2016-05-14 11:14:51 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- single read[0m
2016-05-14 11:14:51 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- reads at different positions[0m
2016-05-14 11:14:51 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- reads at the same position[0m
2016-05-14 11:14:52 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- reads at the same position with clipping[0m
2016-05-14 11:14:52 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- reads on reverse strand[0m
2016-05-14 11:14:53 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- unmapped reads[0m
2016-05-14 11:14:53 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- read pairs[0m
2016-05-14 11:14:53 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- read pairs with fragments[0m
[32m- quality scores[0m
2016-05-14 11:14:53 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- read pairs that cross chromosomes[0m
[32mIndelRealignmentTargetSuite:[0m
2016-05-14 11:14:54 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- checking simple realignment target[0m
2016-05-14 11:14:54 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating simple target from read with deletion[0m
2016-05-14 11:14:54 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating simple target from read with insertion[0m
2016-05-14 11:14:54 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- joining simple realignment targets on same chr[0m
2016-05-14 11:14:54 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- joining simple realignment targets on different chr throws exception[0m
2016-05-14 11:14:54 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating targets from three intersecting reads, same indel[0m
2016-05-14 11:14:54 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating targets from three intersecting reads, two different indel[0m
2016-05-14 11:14:55 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating targets from two disjoint reads[0m
2016-05-14 11:14:55 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating targets for artificial reads: one-by-one[0m
2016-05-14 11:14:55 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating targets for artificial reads: all-at-once (merged)[0m
2016-05-14 11:14:55 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- creating indel targets for mason reads[0m
[32mTwoBitSuite:[0m
[32m- correctly read sequence from .2bit file[0m
[32m- correctly return masked sequences from .2bit file[0m
[32m- correctly return Ns from .2bit file[0m
[32mConsensusSuite:[0m
[32m- test the insertion of a consensus insertion into a reference[0m
[32m- test the insertion of a consensus deletion into a reference[0m
[32m- inserting empty consensus returns the reference[0m
[32mDecadentReadSuite:[0m
[32m- reference position of decadent read[0m
[32m- reference position of decadent read with insertions[0m
[32m- build a decadent read from a read with null qual[0m
[32m- converting bad read should fail[0m
2016-05-14 11:14:56 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:14:56 WARN DecadentRead:64 - Converting read {"readInFragment": 0, "contig": {"contigName": "1", "contigLength": null, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null, "referenceIndex": null}, "start": 248262648, "oldPosition": null, "end": 248262721, "mapq": 23, "readName": null, "sequence": "GATCTTTTCAACAGTTACAGCAGAAAGTTTTCATGGAGAAATGGAATCACACTTCAAATGATTTCATTTTGTTGGG", "qual": "IBBHEFFEKFCKFHFACKFIJFJDCFHFEEDJBCHIFIDDBCGJDBBJAJBJFCIDCACHBDEBHADDDADDAED;", "cigar": "4S1M1D71M", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": false, "properPair": false, "readMapped": true, "mateMapped": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": false, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": "3^C71", "origQual": null, "attributes": null, "recordGroupName": null, "recordGroupSample": null, "mateAlignmentStart": null, "mateAlignmentEnd": null, "mateContig": null, "inferredInsertSize": null} to decadent read failed with java.lang.IllegalArgumentException: Error "(D,Some(3)) (of class scala.Tuple2)" while constructing DecadentRead from Read({"readInFragment": 0, "contig": {"contigName": "1", "contigLength": null, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null, "referenceIndex": null}, "start": 248262648, "oldPosition": null, "end": 248262721, "mapq": 23, "readName": null, "sequence": "GATCTTTTCAACAGTTACAGCAGAAAGTTTTCATGGAGAAATGGAATCACACTTCAAATGATTTCATTTTGTTGGG", "qual": "IBBHEFFEKFCKFHFACKFIJFJDCFHFEEDJBCHIFIDDBCGJDBBJAJBJFCIDCACHBDEBHADDDADDAED;", "cigar": "4S1M1D71M", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": false, "properPair": false, "readMapped": true, "mateMapped": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": false, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": "3^C71", "origQual": null, "attributes": null, "recordGroupName": null, "recordGroupSample": null, "mateAlignmentStart": null, "mateAlignmentEnd": null, "mateContig": null, "inferredInsertSize": null}). Skipping...
[32m- convert an RDD that has an bad read in it with loose validation[0m
2016-05-14 11:14:56 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:14:56 ERROR Executor:96 - Exception in task 1.0 in stage 0.0 (TID 1)
java.lang.IllegalArgumentException: Error "(D,Some(3)) (of class scala.Tuple2)" while constructing DecadentRead from Read({"readInFragment": 0, "contig": {"contigName": "1", "contigLength": null, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null, "referenceIndex": null}, "start": 248262648, "oldPosition": null, "end": 248262721, "mapq": 23, "readName": null, "sequence": "GATCTTTTCAACAGTTACAGCAGAAAGTTTTCATGGAGAAATGGAATCACACTTCAAATGATTTCATTTTGTTGGG", "qual": "IBBHEFFEKFCKFHFACKFIJFJDCFHFEEDJBCHIFIDDBCGJDBBJAJBJFCIDCACHBDEBHADDDADDAED;", "cigar": "4S1M1D71M", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": false, "properPair": false, "readMapped": true, "mateMapped": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": false, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": "3^C71", "origQual": null, "attributes": null, "recordGroupName": null, "recordGroupSample": null, "mateAlignmentStart": null, "mateAlignmentEnd": null, "mateContig": null, "inferredInsertSize": null})
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:42)
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:34)
at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:57)
at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:55)
at scala.collection.Iterator$$anon$11.next(Iterator.scala:328)
at org.apache.spark.util.Utils$.getIteratorSize(Utils.scala:1555)
at org.apache.spark.rdd.RDD$$anonfun$count$1.apply(RDD.scala:1125)
at org.apache.spark.rdd.RDD$$anonfun$count$1.apply(RDD.scala:1125)
at org.apache.spark.SparkContext$$anonfun$runJob$5.apply(SparkContext.scala:1850)
at org.apache.spark.SparkContext$$anonfun$runJob$5.apply(SparkContext.scala:1850)
at org.apache.spark.scheduler.ResultTask.runTask(ResultTask.scala:66)
at org.apache.spark.scheduler.Task.run(Task.scala:88)
at org.apache.spark.executor.Executor$TaskRunner.run(Executor.scala:214)
at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1145)
at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615)
at java.lang.Thread.run(Thread.java:745)
Caused by: scala.MatchError: (D,Some(3)) (of class scala.Tuple2)
at org.bdgenomics.adam.util.MdTag$.apply(MdTag.scala:71)
at org.bdgenomics.adam.rich.RichAlignmentRecord.mdTag$lzycompute(RichAlignmentRecord.scala:98)
at org.bdgenomics.adam.rich.RichAlignmentRecord.mdTag(RichAlignmentRecord.scala:96)
at org.bdgenomics.adam.rich.RichAlignmentRecord.getReferenceBase$1(RichAlignmentRecord.scala:176)
at org.bdgenomics.adam.rich.RichAlignmentRecord.getReferenceContext(RichAlignmentRecord.scala:192)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1$$anonfun$2.apply(RichAlignmentRecord.scala:213)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1$$anonfun$2.apply(RichAlignmentRecord.scala:211)
at scala.collection.TraversableLike$$anonfun$map$1.apply(TraversableLike.scala:244)
at scala.collection.TraversableLike$$anonfun$map$1.apply(TraversableLike.scala:244)
at scala.collection.Iterator$class.foreach(Iterator.scala:727)
at scala.collection.AbstractIterator.foreach(Iterator.scala:1157)
at scala.collection.IterableLike$class.foreach(IterableLike.scala:72)
at scala.collection.AbstractIterable.foreach(Iterable.scala:54)
at scala.collection.TraversableLike$class.map(TraversableLike.scala:244)
at scala.collection.AbstractTraversable.map(Traversable.scala:105)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1.apply(RichAlignmentRecord.scala:211)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1.apply(RichAlignmentRecord.scala:200)
at scala.collection.LinearSeqOptimized$class.foldLeft(LinearSeqOptimized.scala:111)
at scala.collection.immutable.List.foldLeft(List.scala:84)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referenceContexts$lzycompute(RichAlignmentRecord.scala:200)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referenceContexts(RichAlignmentRecord.scala:198)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referencePositions$lzycompute(RichAlignmentRecord.scala:196)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referencePositions(RichAlignmentRecord.scala:196)
at org.bdgenomics.adam.rich.DecadentRead.<init>(DecadentRead.scala:91)
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:38)
... 15 more
2016-05-14 11:14:56 WARN TaskSetManager:71 - Lost task 1.0 in stage 0.0 (TID 1, localhost): java.lang.IllegalArgumentException: Error "(D,Some(3)) (of class scala.Tuple2)" while constructing DecadentRead from Read({"readInFragment": 0, "contig": {"contigName": "1", "contigLength": null, "contigMD5": null, "referenceURL": null, "assembly": null, "species": null, "referenceIndex": null}, "start": 248262648, "oldPosition": null, "end": 248262721, "mapq": 23, "readName": null, "sequence": "GATCTTTTCAACAGTTACAGCAGAAAGTTTTCATGGAGAAATGGAATCACACTTCAAATGATTTCATTTTGTTGGG", "qual": "IBBHEFFEKFCKFHFACKFIJFJDCFHFEEDJBCHIFIDDBCGJDBBJAJBJFCIDCACHBDEBHADDDADDAED;", "cigar": "4S1M1D71M", "oldCigar": null, "basesTrimmedFromStart": 0, "basesTrimmedFromEnd": 0, "readPaired": false, "properPair": false, "readMapped": true, "mateMapped": false, "failedVendorQualityChecks": false, "duplicateRead": false, "readNegativeStrand": false, "mateNegativeStrand": false, "primaryAlignment": false, "secondaryAlignment": false, "supplementaryAlignment": false, "mismatchingPositions": "3^C71", "origQual": null, "attributes": null, "recordGroupName": null, "recordGroupSample": null, "mateAlignmentStart": null, "mateAlignmentEnd": null, "mateContig": null, "inferredInsertSize": null})
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:42)
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:34)
at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:57)
at org.bdgenomics.adam.rich.DecadentRead$$anonfun$cloy$1.apply(DecadentRead.scala:55)
at scala.collection.Iterator$$anon$11.next(Iterator.scala:328)
at org.apache.spark.util.Utils$.getIteratorSize(Utils.scala:1555)
at org.apache.spark.rdd.RDD$$anonfun$count$1.apply(RDD.scala:1125)
at org.apache.spark.rdd.RDD$$anonfun$count$1.apply(RDD.scala:1125)
at org.apache.spark.SparkContext$$anonfun$runJob$5.apply(SparkContext.scala:1850)
at org.apache.spark.SparkContext$$anonfun$runJob$5.apply(SparkContext.scala:1850)
at org.apache.spark.scheduler.ResultTask.runTask(ResultTask.scala:66)
at org.apache.spark.scheduler.Task.run(Task.scala:88)
at org.apache.spark.executor.Executor$TaskRunner.run(Executor.scala:214)
at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1145)
at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615)
at java.lang.Thread.run(Thread.java:745)
Caused by: scala.MatchError: (D,Some(3)) (of class scala.Tuple2)
at org.bdgenomics.adam.util.MdTag$.apply(MdTag.scala:71)
at org.bdgenomics.adam.rich.RichAlignmentRecord.mdTag$lzycompute(RichAlignmentRecord.scala:98)
at org.bdgenomics.adam.rich.RichAlignmentRecord.mdTag(RichAlignmentRecord.scala:96)
at org.bdgenomics.adam.rich.RichAlignmentRecord.getReferenceBase$1(RichAlignmentRecord.scala:176)
at org.bdgenomics.adam.rich.RichAlignmentRecord.getReferenceContext(RichAlignmentRecord.scala:192)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1$$anonfun$2.apply(RichAlignmentRecord.scala:213)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1$$anonfun$2.apply(RichAlignmentRecord.scala:211)
at scala.collection.TraversableLike$$anonfun$map$1.apply(TraversableLike.scala:244)
at scala.collection.TraversableLike$$anonfun$map$1.apply(TraversableLike.scala:244)
at scala.collection.Iterator$class.foreach(Iterator.scala:727)
at scala.collection.AbstractIterator.foreach(Iterator.scala:1157)
at scala.collection.IterableLike$class.foreach(IterableLike.scala:72)
at scala.collection.AbstractIterable.foreach(Iterable.scala:54)
at scala.collection.TraversableLike$class.map(TraversableLike.scala:244)
at scala.collection.AbstractTraversable.map(Traversable.scala:105)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1.apply(RichAlignmentRecord.scala:211)
at org.bdgenomics.adam.rich.RichAlignmentRecord$$anonfun$1.apply(RichAlignmentRecord.scala:200)
at scala.collection.LinearSeqOptimized$class.foldLeft(LinearSeqOptimized.scala:111)
at scala.collection.immutable.List.foldLeft(List.scala:84)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referenceContexts$lzycompute(RichAlignmentRecord.scala:200)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referenceContexts(RichAlignmentRecord.scala:198)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referencePositions$lzycompute(RichAlignmentRecord.scala:196)
at org.bdgenomics.adam.rich.RichAlignmentRecord.referencePositions(RichAlignmentRecord.scala:196)
at org.bdgenomics.adam.rich.DecadentRead.<init>(DecadentRead.scala:91)
at org.bdgenomics.adam.rich.DecadentRead$.apply(DecadentRead.scala:38)
... 15 more
2016-05-14 11:14:56 ERROR TaskSetManager:75 - Task 1 in stage 0.0 failed 1 times; aborting job
[32m- converting an RDD that has an bad read in it with strict validation will throw an error[0m
[32mAlphabetSuite:[0m
[32m- test size of a case-sensitive alphabet[0m
[32m- test apply of a case-sensitive alphabet[0m
[32m- test reverse complement of a case-sensitive alphabet[0m
[32m- test exact reverse complement of a case-sensitive alphabet[0m
[32m- test size of a case-insensitive alphabet[0m
[32m- test apply of a case-insensitive alphabet[0m
[32m- test reverse complement of a case-insensitive alphabet[0m
[32m- test exact reverse complement of a case-insensitive alphabet[0m
[32m- DNA alphabet[0m
[32m- map unknown bases to N[0m
[32mFieldEnumerationSuite:[0m
2016-05-14 11:14:56 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
SLF4J: Failed to load class "org.slf4j.impl.StaticLoggerBinder".
SLF4J: Defaulting to no-operation (NOP) logger implementation
SLF4J: See http://www.slf4j.org/codes.html#StaticLoggerBinder for further details.
[32m- Empty projections are illegal[0m
2016-05-14 11:14:57 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:14:57 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Simple projection on Read works[0m
[32mBroadcastRegionJoinSuite:[0m
[32m- alternating returns an alternating seq of items[0m
[32m- Single region returns itself[0m
[32m- Two adjacent regions will be merged[0m
[32m- Nonoverlapping regions will all be returned[0m
[32m- Many overlapping regions will all be merged[0m
[32m- ADAMRecords return proper references[0m
2016-05-14 11:14:58 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Ensure same reference regions get passed together[0m
2016-05-14 11:14:58 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Overlapping reference regions[0m
2016-05-14 11:14:59 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Multiple reference regions do not throw exception[0m
2016-05-14 11:14:59 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- regionJoin contains the same results as cartesianRegionJoin[0m
[32mCoverageSuite:[0m
[32m- regionToWindows[0m
[32m- calculate empty coverage[0m
[32m- calculate coverage of one region[0m
[32m- calculate coverage of two regions[0m
[32m- calculate coverage of three regions[0m
[32m- calculate coverage of two adjacent regions[0m
[32m- calculate coverage of two nearby regions[0m
[32m- calculate coverage of three out-of-order regions[0m
[32m- calculate coverage of two regions which join at a window boundary[0m
2016-05-14 11:15:00 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find empty coverage[0m
2016-05-14 11:15:01 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of one region[0m
2016-05-14 11:15:01 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of two regions[0m
2016-05-14 11:15:02 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of three regions[0m
2016-05-14 11:15:04 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of two adjacent regions[0m
2016-05-14 11:15:05 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of two nearby regions[0m
2016-05-14 11:15:06 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of three out-of-order regions[0m
2016-05-14 11:15:07 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find coverage of two regions which join at a window boundary[0m
[32mVariantContextConverterSuite:[0m
[32m- Convert GATK site-only SNV to ADAM[0m
[32m- Convert GATK site-only SNV to ADAM with contig conversion[0m
[32m- Convert GATK site-only CNV to ADAM[0m
[32m- Convert GATK SNV w/ genotypes w/ phase information to ADAM[0m
[32m- Convert GATK SNV with different filters to ADAM[0m
[32m- Convert ADAM site-only SNV to GATK[0m
[32m- Convert ADAM site-only SNV to GATK with contig conversion[0m
[32m- Convert ADAM SNV w/ genotypes to GATK[0m
[32m- Convert GATK multi-allelic sites-only SNVs to ADAM[0m
[32m- Convert GATK multi-allelic SNVs to ADAM[0m
[32m- Convert gVCF reference records to ADAM[0m
[32mAttributeSuite:[0m
[32m- test SAMTagAndValue parsing[0m
[32m- Attributes can be correctly re-encoded as text SAM tags[0m
[32mSAMRecordConverterSuite:[0m
[32m- testing the fields in an alignmentRecord obtained from a mapped samRecord conversion[0m
[32m- testing the fields in an alignmentRecord obtained from an unmapped samRecord conversion[0m
[32m- '*' quality gets nulled out[0m
[32mADAMContextSuite:[0m
2016-05-14 11:15:08 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sc.loadParquet should not fail on unmapped reads[0m
2016-05-14 11:15:08 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- sc.loadParquet should not load a file without a type specified[0m
2016-05-14 11:15:09 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can read a small .SAM file[0m
2016-05-14 11:15:09 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can read a small .SAM with all attribute tag types[0m
2016-05-14 11:15:09 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can filter a .SAM file based on quality[0m
[32m- Can convert to phred[0m
[32m- Can convert from phred[0m
2016-05-14 11:15:09 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- findFiles correctly finds a nested set of directories[0m
2016-05-14 11:15:09 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- loadADAMFromPaths can load simple RDDs that have just been saved[0m
2016-05-14 11:15:10 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Can read a .gtf file[0m
2016-05-14 11:15:10 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Can read a .bed file[0m
2016-05-14 11:15:10 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Can read a .narrowPeak file[0m
2016-05-14 11:15:10 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Can read a .interval_list file[0m
2016-05-14 11:15:11 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can read a small .vcf file[0m
2016-05-14 11:15:12 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from interleaved FASTQ: 1[0m
2016-05-14 11:15:12 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from interleaved FASTQ: 2[0m
2016-05-14 11:15:12 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from interleaved FASTQ: 3[0m
2016-05-14 11:15:12 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from interleaved FASTQ: 4[0m
2016-05-14 11:15:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from single ended FASTQ: 1[0m
2016-05-14 11:15:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from single ended FASTQ: 2[0m
2016-05-14 11:15:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from single ended FASTQ: 3[0m
2016-05-14 11:15:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- import records from single ended FASTQ: 4[0m
2016-05-14 11:15:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- filter on load using the filter2 API[0m
[32mRichCigarSuite:[0m
[32m- moving 2 bp from a deletion to a match operator[0m
[32m- moving 2 bp from a insertion to a match operator[0m
[32m- moving 1 base in a two element cigar[0m
[32m- move to start of read[0m
[32mUtilSuite:[0m
[32m- isSameConfig[0m
[32mMDTaggingSuite:[0m
2016-05-14 11:15:14 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test adding MDTags over boundary[0m
2016-05-14 11:15:15 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test adding MDTags; reads span full contig[0m
2016-05-14 11:15:15 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test adding MDTags; reads start inside first fragment[0m
2016-05-14 11:15:15 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test adding MDTags; reads end inside last fragment[0m
2016-05-14 11:15:16 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test adding MDTags; reads start inside first fragment and end inside last fragment[0m
2016-05-14 11:15:16 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test adding MDTags; reads start and end in middle fragements[0m
[32mNormalizationUtilsSuite:[0m
[32m- cannot move an indel left if there are no bases to it's left[0m
[32m- move a simple indel to farthest position left until bases run out[0m
[32m- move a simple indel to farthest position left, past length of indel[0m
[32m- cannot move a left normalized indel in a short tandem repeat[0m
[32m- move an indel in a short tandem repeat[0m
[32m- move an indel in a short tandem repeat of more than 2 bases, where shift is not an integer multiple of repeated sequence length[0m
[32m- moving a simple read with single deletion that cannot shift[0m
[32m- shift an indel left by 0 in a cigar[0m
[32m- shift an indel left by 1 in a cigar[0m
[32m- do not left align a complex read which is already left aligned[0m
[32mSmithWatermanSuite:[0m
[32m- gather max position from simple scoring matrix[0m
[32m- gather max position from irregular scoring matrix[0m
[32m- gather max position from irregular scoring matrix with deletions[0m
[32m- score simple alignment with constant gap[0m
[32m- score irregular scoring matrix[0m
[32m- score irregular scoring matrix with indel[0m
[32m- can unroll cigars correctly[0m
[32m- execute simple trackback[0m
[32m- execute trackback with indel[0m
[32m- run end to end smith waterman for simple reads[0m
[32m- run end to end smith waterman for short sequences with indel[0m
[32m- run end to end smith waterman for longer sequences with snp[0m
[32m- run end to end smith waterman for longer sequences with short indel[0m
[32m- run end to end smith waterman for shorter sequence in longer sequence[0m
[32m- run end to end smith waterman for shorter sequence in longer sequence, with indel[0m
[32mFastaConverterSuite:[0m
2016-05-14 11:15:17 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- find contig index[0m
[32m- convert a single record without naming information[0m
[32m- convert a single record with naming information[0m
2016-05-14 11:15:17 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert single fasta sequence[0m
2016-05-14 11:15:17 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert fasta with multiple sequences[0m
2016-05-14 11:15:17 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert fasta with multiple sequences; short fragment[0m
2016-05-14 11:15:18 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- convert reference fasta file[0m
[32mIndelTableSuite:[0m
[32m- check for indels in a region with known indels[0m
[32m- check for indels in a contig that doesn't exist[0m
[32m- check for indels in a region without known indels[0m
2016-05-14 11:15:18 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- build indel table from rdd of variants[0m
[32mRealignIndelsSuite:[0m
2016-05-14 11:15:18 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- checking mapping to targets for artificial reads[0m
2016-05-14 11:15:19 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- checking alternative consensus for artificial reads[0m
2016-05-14 11:15:19 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- checking extraction of reference from reads[0m
2016-05-14 11:15:19 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- checking realigned reads for artificial input[0m
2016-05-14 11:15:19 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test mismatch quality scoring[0m
2016-05-14 11:15:20 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test mismatch quality scoring for no mismatches[0m
2016-05-14 11:15:20 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test mismatch quality scoring after unpacking read[0m
[32m- we shouldn't try to realign a region with no target[0m
2016-05-14 11:15:20 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- we shouldn't try to realign reads with no indel evidence[0m
2016-05-14 11:15:20 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test OP and OC tags[0m
[32mBaseQualityRecalibrationSuite:[0m
2016-05-14 11:15:21 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- BQSR Test Input #1[0m
2016-05-14 11:15:29 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- BQSR Test Input #1 w/ VCF Sites[0m
[32mProgramRecordSuite:[0m
[32m- convert a sam program record with no optional fields into a program record and v/v[0m
[32m- convert a sam program record into a program record and v/v[0m
[32mSequenceDictionarySuite:[0m
[32m- Convert from sam sequence record and back[0m
[32m- Convert from SAM sequence dictionary file (with extra fields)[0m
[32m- merge into existing dictionary[0m
[32m- Convert from SAM sequence dictionary and back[0m
[32m- Can retrieve sequence by name[0m
[32m- SequenceDictionary's with same single element are equal[0m
[32m- SequenceDictionary's with same two elements are equals[0m
[32m- SequenceDictionary's with different elements are unequal[0m
[32m- SequenceDictionaries with same elements in different order are compatible[0m
[32m- isCompatible tests equality on overlap[0m
[32m- The addition + works correctly[0m
[32m- The append operation ++ works correctly[0m
[32m- ContainsRefName works correctly for different string types[0m
[32m- Apply on name works correctly for different String types[0m
[32m- convert from sam sequence record and back[0m
[32m- convert from sam sequence dictionary and back[0m
[32m- conversion to sam sequence dictionary has correct sort order[0m
[32mGenomicPositionPartitionerSuite:[0m
[32m- partitions the UNMAPPED ReferencePosition into the top partition[0m
[32m- if we do not have a contig for a record, we throw an IAE[0m
[32m- partitioning into N pieces on M total sequence length, where N > M, results in M partitions[0m
[32m- correctly partitions a single dummy sequence into two pieces[0m
[32m- correctly counts cumulative lengths[0m
[32m- correctly partitions positions across two dummy sequences[0m
2016-05-14 11:15:35 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:15:35 WARN TaskSetManager:71 - Stage 0 contains a task of very large size (131 KB). The maximum recommended task size is 100 KB.
2016-05-14 11:15:35 WARN TaskSetManager:71 - Stage 1 contains a task of very large size (131 KB). The maximum recommended task size is 100 KB.
[32m- test that we can range partition ADAMRecords[0m
2016-05-14 11:15:36 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- test that simple partitioning works okay on a reasonable set of ADAMRecords[0m
[32mRichAlignmentRecordSuite:[0m
[32m- referenceLengthFromCigar[0m
[32m- Unclipped Start[0m
[32m- Unclipped End[0m
[32m- Illumina Optics[0m
[32m- Cigar Clipping Sequence[0m
[32m- tags contains optional fields[0m
[32m- Reference Positions[0m
[32m- read overlap unmapped read[0m
[32m- read overlap reference position[0m
[32m- read overlap same position different contig[0m
[32mGeneSuite:[0m
2016-05-14 11:15:36 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can load a set of gene models from an Ensembl GTF file[0m
2016-05-14 11:15:37 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can load a set of gene models from a Gencode GTF file[0m
2016-05-14 11:15:37 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- chr20 gencode transcript sequences match the published sequences[0m
[32mMapToolsSuite:[0m
[32m- add two nonzero integer maps[0m
[32m- add two nonzero float maps[0m
[32m- adding an empty map is the identity[0m
[32mRecordGroupDictionarySuite:[0m
[32m- simple conversion to and from sam read group[0m
[32m- sample name must be set[0m
[32m- simple equality checks[0m
[36mRun completed in 1 minute, 26 seconds.[0m
[36mTotal number of tests run: 373[0m
[36mSuites: completed 52, aborted 0[0m
[36mTests: succeeded 373, failed 0, canceled 0, ignored 0, pending 0[0m
[32mAll tests passed.[0m
May 14, 2016 11:15:14 AM INFO: org.apache.parquet.filter2.compat.FilterCompat: Filtering using predicate: eq(start, 16097631)
May 14, 2016 11:15:14 AM INFO: org.apache.parquet.filter2.compat.FilterCompat: Filtering using predicate: eq(start, 16097631)
[INFO]
[INFO] --- maven-jar-plugin:2.6:jar (default-jar) @ adam-core_2.10 ---
[INFO]
[INFO] --- maven-jar-plugin:2.6:test-jar (default) @ adam-core_2.10 ---
[INFO] Building jar: /home/xubo/cloud/adam-2.10-0.19-git/adam-core/target/adam-core_2.10-0.19.0-tests.jar
[INFO]
[INFO] >>> scala-maven-plugin:3.2.2:doc-jar (attach-scaladocs) > generate-sources @ adam-core_2.10 >>>
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-core_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-core_2.10 ---
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-source (add-source) @ adam-core_2.10 ---
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/main/scala added.
[INFO]
[INFO] <<< scala-maven-plugin:3.2.2:doc-jar (attach-scaladocs) < generate-sources @ adam-core_2.10 <<<
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:doc-jar (attach-scaladocs) @ adam-core_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-metrics_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-io_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-cli_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.scoverage:scalac-scoverage-plugin_2.10:1.1.1 requires scala version: 2.10.4
[WARNING] org.bdgenomics.adam:adam-core_2.10:0.19.0 requires scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-misc_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-metrics_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-io_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.bdgenomics.utils:utils-cli_2.10:0.2.4 requires scala version: 2.10.4
[WARNING] org.scoverage:scalac-scoverage-plugin_2.10:1.1.1 requires scala version: 2.10.4
[WARNING] org.bdgenomics.adam:adam-core_2.10:0.19.0 requires scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
warning: there were 33 feature warning(s); re-run with -feature for details
model contains 258 documentable templates
/home/xubo/cloud/adam-2.10-0.19-git/adam-core/src/main/scala/org/bdgenomics/adam/models/VariantContext.scala:24: warning: Could not find any member to link for "org.bdgenomics.adam.rdd.variation.VariationContext".
/**
^
two warnings found
[INFO] Building jar: /home/xubo/cloud/adam-2.10-0.19-git/adam-core/target/adam-core_2.10-0.19.0-javadoc.jar
[INFO]
[INFO] --- maven-install-plugin:2.5.2:install (default-install) @ adam-core_2.10 ---
[INFO] Installing /home/xubo/cloud/adam-2.10-0.19-git/adam-core/target/adam-core_2.10-0.19.0.jar to /home/xubo/.m2/repository/org/bdgenomics/adam/adam-core_2.10/0.19.0/adam-core_2.10-0.19.0.jar
[INFO] Installing /home/xubo/cloud/adam-2.10-0.19-git/adam-core/pom.xml to /home/xubo/.m2/repository/org/bdgenomics/adam/adam-core_2.10/0.19.0/adam-core_2.10-0.19.0.pom
[INFO] Installing /home/xubo/cloud/adam-2.10-0.19-git/adam-core/target/adam-core_2.10-0.19.0-tests.jar to /home/xubo/.m2/repository/org/bdgenomics/adam/adam-core_2.10/0.19.0/adam-core_2.10-0.19.0-tests.jar
[INFO] Installing /home/xubo/cloud/adam-2.10-0.19-git/adam-core/target/adam-core_2.10-0.19.0-javadoc.jar to /home/xubo/.m2/repository/org/bdgenomics/adam/adam-core_2.10/0.19.0/adam-core_2.10-0.19.0-javadoc.jar
[INFO]
[INFO] ------------------------------------------------------------------------
[INFO] Building ADAM_2.10: APIs for Java 0.19.0
[INFO] ------------------------------------------------------------------------
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-apis_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-apis_2.10 ---
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-source (add-source) @ adam-apis_2.10 ---
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/main/scala added.
[INFO]
[INFO] --- scalariform-maven-plugin:0.1.4:format (default-cli) @ adam-apis_2.10 ---
[INFO] Modified 0 of 4 .scala files
[INFO]
[INFO] --- maven-resources-plugin:2.7:resources (default-resources) @ adam-apis_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] skip non existing resourceDirectory /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/main/resources
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:compile (scala-compile-first) @ adam-apis_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-compiler-plugin:3.3:compile (default-compile) @ adam-apis_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-test-source (add-test-source) @ adam-apis_2.10 ---
[INFO] Test Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/test/scala added.
[INFO]
[INFO] --- maven-resources-plugin:2.7:testResources (default-testResources) @ adam-apis_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] skip non existing resourceDirectory /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/test/resources
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:testCompile (scala-test-compile-first) @ adam-apis_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-compiler-plugin:3.3:testCompile (default-testCompile) @ adam-apis_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-surefire-plugin:2.18.1:test (default-test) @ adam-apis_2.10 ---
[INFO] Tests are skipped.
[INFO]
[INFO] --- scalatest-maven-plugin:1.0:test (test) @ adam-apis_2.10 ---
[36mDiscovery starting.[0m
[36mDiscovery completed in 270 milliseconds.[0m
[36mRun starting. Expected test count is: 2[0m
[32mJavaADAMContextSuite:[0m
2016-05-14 11:16:17 WARN NativeCodeLoader:62 - Unable to load native-hadoop library for your platform... using builtin-java classes where applicable
2016-05-14 11:16:19 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can read a small .SAM file[0m
2016-05-14 11:16:21 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
SLF4J: Failed to load class "org.slf4j.impl.StaticLoggerBinder".
SLF4J: Defaulting to no-operation (NOP) logger implementation
SLF4J: See http://www.slf4j.org/codes.html#StaticLoggerBinder for further details.
[32m- can read a small .SAM file inside of java[0m
[36mRun completed in 6 seconds, 913 milliseconds.[0m
[36mTotal number of tests run: 2[0m
[36mSuites: completed 2, aborted 0[0m
[36mTests: succeeded 2, failed 0, canceled 0, ignored 0, pending 0[0m
[32mAll tests passed.[0m
[INFO]
[INFO] --- maven-jar-plugin:2.6:jar (default-jar) @ adam-apis_2.10 ---
[INFO]
[INFO] --- maven-jar-plugin:2.6:test-jar (default) @ adam-apis_2.10 ---
[INFO]
[INFO] >>> scala-maven-plugin:3.2.2:doc-jar (attach-scaladocs) > generate-sources @ adam-apis_2.10 >>>
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-apis_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-apis_2.10 ---
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-source (add-source) @ adam-apis_2.10 ---
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/src/main/scala added.
[INFO]
[INFO] <<< scala-maven-plugin:3.2.2:doc-jar (attach-scaladocs) < generate-sources @ adam-apis_2.10 <<<
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:doc-jar (attach-scaladocs) @ adam-apis_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
warning: there were 2 feature warning(s); re-run with -feature for details
model contains 11 documentable templates
one warning found
[INFO] Building jar: /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/target/adam-apis_2.10-0.19.0-javadoc.jar
[INFO]
[INFO] --- maven-install-plugin:2.5.2:install (default-install) @ adam-apis_2.10 ---
[INFO] Installing /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/target/adam-apis_2.10-0.19.0.jar to /home/xubo/.m2/repository/org/bdgenomics/adam/adam-apis_2.10/0.19.0/adam-apis_2.10-0.19.0.jar
[INFO] Installing /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/pom.xml to /home/xubo/.m2/repository/org/bdgenomics/adam/adam-apis_2.10/0.19.0/adam-apis_2.10-0.19.0.pom
[INFO] Installing /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/target/adam-apis_2.10-0.19.0-tests.jar to /home/xubo/.m2/repository/org/bdgenomics/adam/adam-apis_2.10/0.19.0/adam-apis_2.10-0.19.0-tests.jar
[INFO] Installing /home/xubo/cloud/adam-2.10-0.19-git/adam-apis/target/adam-apis_2.10-0.19.0-javadoc.jar to /home/xubo/.m2/repository/org/bdgenomics/adam/adam-apis_2.10/0.19.0/adam-apis_2.10-0.19.0-javadoc.jar
[INFO]
[INFO] ------------------------------------------------------------------------
[INFO] Building ADAM_2.10: CLI 0.19.0
[INFO] ------------------------------------------------------------------------
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-cli_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-cli_2.10 ---
[INFO]
[INFO] --- git-commit-id-plugin:2.2.0:revision (default) @ adam-cli_2.10 ---
[INFO]
[INFO] --- templating-maven-plugin:1.0-alpha-3:filter-sources (filter-src) @ adam-cli_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 1 resource
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/generated-sources/java-templates added.
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-source (add-source) @ adam-cli_2.10 ---
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/src/main/scala added.
[INFO]
[INFO] --- scalariform-maven-plugin:0.1.4:format (default-cli) @ adam-cli_2.10 ---
[INFO] Modified 0 of 36 .scala files
[INFO]
[INFO] --- maven-resources-plugin:2.7:resources (default-resources) @ adam-cli_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 1 resource
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:compile (scala-compile-first) @ adam-cli_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/generated-sources/java-templates:-1: info: compiling
[INFO] /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/src/main/scala:-1: info: compiling
[INFO] Compiling 26 source files to /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/scala-2.10.4/classes at 1463195790028
[INFO] prepare-compile in 0 s
[INFO] compile in 22 s
[INFO]
[INFO] --- maven-compiler-plugin:3.3:compile (default-compile) @ adam-cli_2.10 ---
[INFO] Changes detected - recompiling the module!
[INFO] Compiling 1 source file to /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/scala-2.10.4/classes
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-test-source (add-test-source) @ adam-cli_2.10 ---
[INFO] Test Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/src/test/scala added.
[INFO]
[INFO] --- maven-resources-plugin:2.7:testResources (default-testResources) @ adam-cli_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 9 resources
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:testCompile (scala-test-compile-first) @ adam-cli_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-compiler-plugin:3.3:testCompile (default-testCompile) @ adam-cli_2.10 ---
[INFO] Nothing to compile - all classes are up to date
[INFO]
[INFO] --- maven-surefire-plugin:2.18.1:test (default-test) @ adam-cli_2.10 ---
[INFO] Tests are skipped.
[INFO]
[INFO] --- scalatest-maven-plugin:1.0:test (test) @ adam-cli_2.10 ---
[36mDiscovery starting.[0m
[36mDiscovery completed in 317 milliseconds.[0m
[36mRun starting. Expected test count is: 33[0m
[32mTransformSuite:[0m
2016-05-14 11:16:55 WARN NativeCodeLoader:62 - Unable to load native-hadoop library for your platform... using builtin-java classes where applicable
2016-05-14 11:16:57 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:16:59 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:16:59 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- unordered sam to unordered sam[0m
2016-05-14 11:17:00 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:01 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:17:01 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- unordered sam to ordered sam[0m
2016-05-14 11:17:01 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
SLF4J: Failed to load class "org.slf4j.impl.StaticLoggerBinder".
SLF4J: Defaulting to no-operation (NOP) logger implementation
SLF4J: See http://www.slf4j.org/codes.html#StaticLoggerBinder for further details.
2016-05-14 11:17:02 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:17:02 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- unordered sam, to adam, to sam[0m
2016-05-14 11:17:03 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:04 WARN AlignmentRecordRDDFunctions:520 - Caught exception when merging via Hadoop FileSystem API:
java.lang.UnsupportedOperationException: Not implemented by the RawLocalFileSystem FileSystem implementation
2016-05-14 11:17:04 WARN AlignmentRecordRDDFunctions:521 - Retrying as manual copy from the driver which will degrade performance.
[32m- unordered sam, to adam, to ordered sam[0m
[32mFlattenSuite:[0m
2016-05-14 11:17:04 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can flatten a simple VCF file[0m
[32mFlagStatSuite:[0m
2016-05-14 11:17:05 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- Standard FlagStat test[0m
[32mViewSuite:[0m
2016-05-14 11:17:06 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:07 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -f 0 -F 0 is a no-op[0m
2016-05-14 11:17:08 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:08 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- no -f or -F args is a no-op[0m
2016-05-14 11:17:09 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:09 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -f 4: only unmapped reads[0m
2016-05-14 11:17:09 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:10 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -F 4: only mapped reads[0m
2016-05-14 11:17:10 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:10 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -f 4 -F 8: unmapped reads with mapped mates[0m
2016-05-14 11:17:11 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:11 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -f 12: unmapped reads with unmapped mates[0m
2016-05-14 11:17:11 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:11 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -g 12: reads that are unmapped or whose mate is unmapped[0m
2016-05-14 11:17:12 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:12 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -F 12: mapped reads with mapped mates[0m
2016-05-14 11:17:12 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -g 36: unmapped reads or reads with mate on negative strand[0m
2016-05-14 11:17:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:13 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- -F 36: unmapped reads or reads with mate on negative strand[0m
[32mPluginExecutorSuite:[0m
2016-05-14 11:17:14 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- take10 works correctly on example SAM[0m
2016-05-14 11:17:14 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- java take10 works correctly on example SAM[0m
2016-05-14 11:17:14 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- takeN works correctly on example SAM with arg of '3'[0m
[32mADAM2FastaSuite:[0m
2016-05-14 11:17:15 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- round trip FASTA to nucleotide contig fragments in ADAM format to FASTA[0m
[32mFeatures2ADAMSuite:[0m
[33m- can convert a simple BED file !!! IGNORED !!![0m
2016-05-14 11:17:16 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
[32m- can convert a simple wigfix file[0m
[32mAboutSuite:[0m
[32m- template variables have been replaced[0m
[32m- templated values are not empty[0m
[32mADAMMainSuite:[0m
[32m- default command groups is not empty[0m
[32m- module provides default command groups[0m
[32m- inject default command groups when called via main[0m
[32m- command groups is empty when called via apply[0m
[32m- single command group[0m
[32m- add new command group to default command groups[0m
[32m- module restores default command groups when called via apply[0m
[32m- custom module with single command group[0m
[32m- custom module with new command group added to default command groups[0m
[32mAdam2FastqSuite:[0m
2016-05-14 11:17:16 WARN MetricsSystem:71 - Using default name DAGScheduler for source because spark.app.id is not set.
2016-05-14 11:17:18 ERROR AlignmentRecordRDDFunctions:75 - Found 16 read names that don't occur exactly twice:
1x: 16
Samples:
SRR062634.16445865
SRR062634.9119161
SRR062634.17190076
SRR062634.17969132
SRR062634.7301099
SRR062634.2087100
SRR062634.20911784
SRR062634.16769670
SRR062634.18958430
SRR062634.12099057
SRR062634.12606172
SRR062634.14985224
SRR062634.10448889
SRR062634.4789722
SRR062634.3203184
SRR062634.17698657
[32m- convert SAM to paired FASTQ[0m
[36mRun completed in 25 seconds, 412 milliseconds.[0m
[36mTotal number of tests run: 33[0m
[36mSuites: completed 11, aborted 0[0m
[36mTests: succeeded 33, failed 0, canceled 0, ignored 1, pending 0[0m
[32mAll tests passed.[0m
[INFO]
[INFO] --- maven-jar-plugin:2.6:jar (default-jar) @ adam-cli_2.10 ---
[INFO] Building jar: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/adam-cli_2.10-0.19.0.jar
[INFO]
[INFO] --- maven-shade-plugin:2.4.1:shade (default) @ adam-cli_2.10 ---
[INFO] Including commons-cli:commons-cli:jar:1.2 in the shaded jar.
[INFO] Including commons-httpclient:commons-httpclient:jar:3.1 in the shaded jar.
[INFO] Including commons-codec:commons-codec:jar:1.4 in the shaded jar.
[INFO] Including commons-logging:commons-logging:jar:1.1.3 in the shaded jar.
[INFO] Including org.apache.commons:commons-compress:jar:1.4.1 in the shaded jar.
[INFO] Including org.codehaus.jackson:jackson-core-asl:jar:1.9.13 in the shaded jar.
[INFO] Including org.codehaus.jackson:jackson-mapper-asl:jar:1.9.13 in the shaded jar.
[INFO] Including com.google.code.findbugs:jsr305:jar:1.3.9 in the shaded jar.
[INFO] Including org.slf4j:slf4j-api:jar:1.7.10 in the shaded jar.
[INFO] Including log4j:log4j:jar:1.2.17 in the shaded jar.
[INFO] Including org.xerial.snappy:snappy-java:jar:1.1.1.7 in the shaded jar.
[INFO] Including com.thoughtworks.paranamer:paranamer:jar:2.6 in the shaded jar.
[INFO] Including org.bdgenomics.utils:utils-io_2.10:jar:0.2.4 in the shaded jar.
[INFO] Including org.bdgenomics.utils:utils-misc_2.10:jar:0.2.4 in the shaded jar.
[INFO] Including org.apache.httpcomponents:httpclient:jar:4.5.1 in the shaded jar.
[INFO] Including org.apache.httpcomponents:httpcore:jar:4.4.3 in the shaded jar.
[INFO] Including org.bdgenomics.utils:utils-cli_2.10:jar:0.2.4 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-avro:jar:1.8.1 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-column:jar:1.8.1 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-common:jar:1.8.1 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-encoding:jar:1.8.1 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-hadoop:jar:1.8.1 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-jackson:jar:1.8.1 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-format:jar:2.3.0-incubating in the shaded jar.
[INFO] Including org.bdgenomics.utils:utils-metrics_2.10:jar:0.2.4 in the shaded jar.
[INFO] Including com.netflix.servo:servo-core:jar:0.10.0 in the shaded jar.
[INFO] Including com.google.code.findbugs:annotations:jar:2.0.0 in the shaded jar.
[INFO] Including com.netflix.servo:servo-internal:jar:0.10.0 in the shaded jar.
[INFO] Including org.scoverage:scalac-scoverage-plugin_2.10:jar:1.1.1 in the shaded jar.
[INFO] Including org.bdgenomics.bdg-formats:bdg-formats:jar:0.7.0 in the shaded jar.
[INFO] Including org.apache.avro:avro:jar:1.7.7 in the shaded jar.
[INFO] Including org.bdgenomics.adam:adam-core_2.10:jar:0.19.0 in the shaded jar.
[INFO] Including com.esotericsoftware.kryo:kryo:jar:2.24.0 in the shaded jar.
[INFO] Including com.esotericsoftware.minlog:minlog:jar:1.2 in the shaded jar.
[INFO] Including org.objenesis:objenesis:jar:2.1 in the shaded jar.
[INFO] Including commons-io:commons-io:jar:1.3.2 in the shaded jar.
[INFO] Including it.unimi.dsi:fastutil:jar:6.6.5 in the shaded jar.
[INFO] Including org.apache.parquet:parquet-scala_2.10:jar:1.8.1 in the shaded jar.
[INFO] Including org.seqdoop:hadoop-bam:jar:7.1.0 in the shaded jar.
[INFO] Including com.github.samtools:htsjdk:jar:1.139 in the shaded jar.
[INFO] Including org.apache.commons:commons-jexl:jar:2.1.1 in the shaded jar.
[INFO] Including org.tukaani:xz:jar:1.5 in the shaded jar.
[INFO] Including org.apache.ant:ant:jar:1.8.2 in the shaded jar.
[INFO] Including org.apache.ant:ant-launcher:jar:1.8.2 in the shaded jar.
[INFO] Including com.google.guava:guava:jar:16.0.1 in the shaded jar.
[INFO] Including org.bdgenomics.adam:adam-apis_2.10:jar:0.19.0 in the shaded jar.
[INFO] Including org.scala-lang:scala-library:jar:2.10.4 in the shaded jar.
[INFO] Including org.slf4j:slf4j-log4j12:jar:1.7.12 in the shaded jar.
[INFO] Including args4j:args4j:jar:2.0.31 in the shaded jar.
[INFO] Including net.codingwell:scala-guice_2.10:jar:4.0.0 in the shaded jar.
[INFO] Including com.google.inject:guice:jar:4.0 in the shaded jar.
[INFO] Including javax.inject:javax.inject:jar:1 in the shaded jar.
[INFO] Including aopalliance:aopalliance:jar:1.0 in the shaded jar.
[INFO] Including com.google.inject.extensions:guice-multibindings:jar:4.0 in the shaded jar.
[WARNING] annotations-2.0.0.jar, jsr305-1.3.9.jar define 34 overlapping classes:
[WARNING] - javax.annotation.Nonnegative
[WARNING] - javax.annotation.CheckForSigned
[WARNING] - javax.annotation.CheckForNull
[WARNING] - javax.annotation.Tainted
[WARNING] - javax.annotation.meta.TypeQualifierValidator
[WARNING] - javax.annotation.meta.TypeQualifier
[WARNING] - javax.annotation.Syntax
[WARNING] - javax.annotation.Detainted
[WARNING] - javax.annotation.Nonnull$Checker
[WARNING] - javax.annotation.meta.TypeQualifierNickname
[WARNING] - 24 more...
[WARNING] maven-shade-plugin has detected that some class files are
[WARNING] present in two or more JARs. When this happens, only one
[WARNING] single version of the class is copied to the uber jar.
[WARNING] Usually this is not harmful and you can skip these warnings,
[WARNING] otherwise try to manually exclude artifacts based on
[WARNING] mvn dependency:tree -Ddetail=true and the above output.
[WARNING] See http://docs.codehaus.org/display/MAVENUSER/Shade+Plugin
[INFO] Replacing original artifact with shaded artifact.
[INFO] Replacing /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/adam-cli_2.10-0.19.0.jar with /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/adam-cli_2.10-0.19.0-shaded.jar
[INFO]
[INFO] >>> scala-maven-plugin:3.2.2:doc-jar (attach-scaladocs) > generate-sources @ adam-cli_2.10 >>>
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-versions) @ adam-cli_2.10 ---
[INFO]
[INFO] --- maven-enforcer-plugin:1.0:enforce (enforce-maven) @ adam-cli_2.10 ---
[INFO]
[INFO] --- git-commit-id-plugin:2.2.0:revision (default) @ adam-cli_2.10 ---
[INFO]
[INFO] --- templating-maven-plugin:1.0-alpha-3:filter-sources (filter-src) @ adam-cli_2.10 ---
[INFO] Using 'UTF-8' encoding to copy filtered resources.
[INFO] Copying 1 resource
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/generated-sources/java-templates added.
[INFO]
[INFO] --- build-helper-maven-plugin:1.9.1:add-source (add-source) @ adam-cli_2.10 ---
[INFO] Source directory: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/src/main/scala added.
[INFO]
[INFO] <<< scala-maven-plugin:3.2.2:doc-jar (attach-scaladocs) < generate-sources @ adam-cli_2.10 <<<
[INFO]
[INFO] --- scala-maven-plugin:3.2.2:doc-jar (attach-scaladocs) @ adam-cli_2.10 ---
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
[WARNING] Expected all dependencies to require Scala version: 2.10.4
[WARNING] com.twitter:chill_2.10:0.5.0 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-remote_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-actor_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] com.typesafe.akka:akka-slf4j_2.10:2.3.11 requires scala version: 2.10.4
[WARNING] org.apache.spark:spark-core_2.10:1.5.2 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-jackson_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-ast_2.10:3.2.10 requires scala version: 2.10.4
[WARNING] org.json4s:json4s-core_2.10:3.2.10 requires scala version: 2.10.0
[WARNING] Multiple versions of scala libraries detected!
model contains 81 documentable templates
[INFO] Building jar: /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/adam-cli_2.10-0.19.0-javadoc.jar
[INFO]
[INFO] --- maven-install-plugin:2.5.2:install (default-install) @ adam-cli_2.10 ---
[INFO] Installing /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/adam-cli_2.10-0.19.0.jar to /home/xubo/.m2/repository/org/bdgenomics/adam/adam-cli_2.10/0.19.0/adam-cli_2.10-0.19.0.jar
[INFO] Installing /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/pom.xml to /home/xubo/.m2/repository/org/bdgenomics/adam/adam-cli_2.10/0.19.0/adam-cli_2.10-0.19.0.pom
[INFO] Installing /home/xubo/cloud/adam-2.10-0.19-git/adam-cli/target/adam-cli_2.10-0.19.0-javadoc.jar to /home/xubo/.m2/repository/org/bdgenomics/adam/adam-cli_2.10/0.19.0/adam-cli_2.10-0.19.0-javadoc.jar
[INFO] ------------------------------------------------------------------------
[INFO] Reactor Summary:
[INFO]
[INFO] ADAM_2.10 .......................................... SUCCESS [ 9.207 s]
[INFO] ADAM_2.10: Core .................................... SUCCESS [02:15 min]
[INFO] ADAM_2.10: APIs for Java ........................... SUCCESS [ 14.505 s]
[INFO] ADAM_2.10: CLI ..................................... SUCCESS [01:12 min]
[INFO] ------------------------------------------------------------------------
[INFO] BUILD SUCCESS
[INFO] ------------------------------------------------------------------------
[INFO] Total time: 03:51 min
[INFO] Finished at: 2016-05-14T11:17:40+08:00
[INFO] Final Memory: 75M/437M
[INFO] ------------------------------------------------------------------------