Leetcode-187.Repeated DNA Sequences

Problem Description:
All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: “ACGAATTCCG”. When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.
Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.
For example,
Given s = “AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT”,

Return:
[“AAAAACCCCC”, “CCCCCAAAAA”].

---

Analysis:
You might think it’s a easy string matching problem.You can starting from the first letter of the string, extract the next 10 chars and check whether it has occurred and not exists in the result. And repeat the above the process.However you would get MLE in the OJ.
So, we need to save space. Since there are only four letters in the string, we could use 2 bits to represent each letter. Then the 10-letter substring will cost 20 bits and could fit in a 32 bit integer.

Simple

vector<string> findRepeatedDnaSequences(string s) {
    int n = s.size();
    vector<string> res;
    unordered_map<int, int> mp;
    if (n < 11) return res;
    for (int i = 0; i < n - 9; ++i)
    {
        string t = s.substr(i, 10);
        if(mp[hash_func(t)]++ == 1)
            res.push_back(t);
    }
    return res;

}
int hash_func(string s)
{
    int res = 0;
    for (int i = 0; i < 10; ++i)
    {
        int t = 0;
        if (s[i] == 'C')
            t = 1;
        else if (s[i] == 'G')
            t = 2;
        else if (s[i] == 'T')
            t = 3;
        res = ((res << 2) | t);
    }
    return res;
}

Shorter version in this link
This is real roll hash, not like the above solution

vector<string> findRepeatedDnaSequences(string s) {
    unordered_map<int, int> m;
    vector<string> r;
    int t = 0, i = 0, ss = s.size();
    while (i < 9)
        t = t << 3 | s[i++] & 7;
    while (i < ss)
        if (m[t = t << 3 & 0x3FFFFFFF | s[i++] & 7]++ == 1)
            r.push_back(s.substr(i - 10, 10));
    return r;
}